BOP1 Rabbit Polyclonal Antibody

Order Now:

BOP1 Polyclonal Antibody

ABP57918-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human BOP1 protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of BOP1 from Human, Mouse, Rat. This BOP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BOP1 protein at amino acid sequence of 110-190

BOP1 Polyclonal Antibody

ABP57918-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human BOP1 protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of BOP1 from Human, Mouse, Rat. This BOP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BOP1 protein at amino acid sequence of 110-190

BOP1 antibody

70R-2410 50 ug
EUR 467
Description: Rabbit polyclonal BOP1 antibody raised against the N terminal of BOP1

BOP1 antibody

70R-2945 50 ug
EUR 467
Description: Rabbit polyclonal BOP1 antibody raised against the N terminal of BOP1

BOP1 Antibody

46933-100ul 100ul
EUR 252

Bop1/ Rat Bop1 ELISA Kit

ELI-11933r 96 Tests
EUR 886

BOP1 Conjugated Antibody

C46933 100ul
EUR 397

Anti-BOP1 antibody

STJ191341 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to BOP1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human Ribosome biogenesis protein BOP1, BOP1 ELISA KIT

ELI-11932h 96 Tests
EUR 824

Mouse Ribosome biogenesis protein BOP1, Bop1 ELISA KIT

ELI-33369m 96 Tests
EUR 865

Human Ribosome Biogenesis Protein BOP1 (BOP1) ELISA Kit

abx384634-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Ribosome Biogenesis Protein BOP1 (BOP1) ELISA Kit

abx388693-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Ribosome Biogenesis Protein BOP1 (BOP1) ELISA Kit

abx391027-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

BOP1 Blocking Peptide

33R-5670 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BOP1 antibody, catalog no. 70R-2410

BOP1 Blocking Peptide

33R-7197 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BOP1 antibody, catalog no. 70R-2945

BOP1 cloning plasmid

CSB-CL621760HU-10ug 10ug
EUR 737
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2241
  • Sequence: atggcgggttcgcggggtgcggggcgcacggcggcgccgagcgtgcggccggagaagcggcggtctgagcccgaactggagcctgagcccgagccggagccccccctcctctgcacctctcctctcagccacagcaccggcagcgattctggcgtctccgacagcgaggagagtg
  • Show more
Description: A cloning plasmid for the BOP1 gene.


PVT14148 2 ug
EUR 599

Bop1 ELISA Kit| Rat Ribosome biogenesis protein BOP1 ELISA Kit

EF018380 96 Tests
EUR 689

Bop1 ELISA Kit| Mouse Ribosome biogenesis protein BOP1 ELISA Ki

EF014318 96 Tests
EUR 689

Rat BOP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF004671 96 Tests
EUR 689

Human BOP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse BOP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BOP1 Recombinant Protein (Human)

RP003163 100 ug Ask for price

BOP1 Recombinant Protein (Rat)

RP192341 100 ug Ask for price

BOP1 Recombinant Protein (Mouse)

RP119774 100 ug Ask for price

BOP1 ORF Vector (Human) (pORF)

ORF001055 1.0 ug DNA
EUR 95

Bop1 ORF Vector (Mouse) (pORF)

ORF039926 1.0 ug DNA
EUR 506

Bop1 ORF Vector (Rat) (pORF)

ORF064115 1.0 ug DNA
EUR 506

BOP1 sgRNA CRISPR Lentivector set (Human)

K0191801 3 x 1.0 ug
EUR 339

Bop1 sgRNA CRISPR Lentivector set (Rat)

K7224901 3 x 1.0 ug
EUR 339

Bop1 sgRNA CRISPR Lentivector set (Mouse)

K3965401 3 x 1.0 ug
EUR 339

BOP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0191802 1.0 ug DNA
EUR 154

BOP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0191803 1.0 ug DNA
EUR 154

BOP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0191804 1.0 ug DNA
EUR 154

Bop1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7224902 1.0 ug DNA
EUR 154

Bop1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7224903 1.0 ug DNA
EUR 154

Bop1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7224904 1.0 ug DNA
EUR 154

Bop1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3965402 1.0 ug DNA
EUR 154

Bop1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3965403 1.0 ug DNA
EUR 154

Bop1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3965404 1.0 ug DNA
EUR 154

BOP1 Protein Vector (Human) (pPB-C-His)

PV004217 500 ng
EUR 329

BOP1 Protein Vector (Human) (pPB-N-His)

PV004218 500 ng
EUR 329

BOP1 Protein Vector (Human) (pPM-C-HA)

PV004219 500 ng
EUR 329

BOP1 Protein Vector (Human) (pPM-C-His)

PV004220 500 ng
EUR 329

BOP1 Protein Vector (Human) (pPB-His-MBP)

PV327318 500 ng
EUR 329

BOP1 Protein Vector (Human) (pPB-His-GST)

PV327319 500 ng
EUR 329

BOP1 Protein Vector (Rat) (pPB-C-His)

PV256458 500 ng
EUR 1166

BOP1 Protein Vector (Rat) (pPB-N-His)

PV256459 500 ng
EUR 1166

BOP1 Protein Vector (Rat) (pPM-C-HA)

PV256460 500 ng
EUR 1166

BOP1 Protein Vector (Rat) (pPM-C-His)

PV256461 500 ng
EUR 1166

BOP1 Protein Vector (Mouse) (pPB-C-His)

PV159702 500 ng
EUR 1065

BOP1 Protein Vector (Mouse) (pPB-N-His)

PV159703 500 ng
EUR 1065

BOP1 Protein Vector (Mouse) (pPM-C-HA)

PV159704 500 ng
EUR 1065

BOP1 Protein Vector (Mouse) (pPM-C-His)

PV159705 500 ng
EUR 1065

Bop1 3'UTR Luciferase Stable Cell Line

TU201385 1.0 ml Ask for price

Bop1 3'UTR GFP Stable Cell Line

TU152808 1.0 ml Ask for price

BOP1 3'UTR Luciferase Stable Cell Line

TU001861 1.0 ml
EUR 1394

Bop1 3'UTR Luciferase Stable Cell Line

TU102808 1.0 ml Ask for price

BOP1 3'UTR GFP Stable Cell Line

TU051861 1.0 ml
EUR 1394

Bop1 3'UTR GFP Stable Cell Line

TU251385 1.0 ml Ask for price

BOP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV661063 1.0 ug DNA
EUR 1355

BOP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV661067 1.0 ug DNA
EUR 1355

BOP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV661068 1.0 ug DNA
EUR 1355

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

BOP1 Rabbit Polyclonal Antibody