CCL16 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

CCL16 Polyclonal Antibody

ES10265-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CCL16 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCL16 Polyclonal Antibody

ES10265-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CCL16 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCL16 Rabbit pAb

A15317-100ul 100 ul
EUR 308

CCL16 Rabbit pAb

A15317-200ul 200 ul
EUR 459

CCL16 Rabbit pAb

A15317-20ul 20 ul
EUR 183

CCL16 Rabbit pAb

A15317-50ul 50 ul
EUR 223

CCL16 antibody

70R-10494 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CCL16 antibody

CCL16 Antibody

46941-100ul 100ul
EUR 252

CCL16 Antibody

37464-100ul 100ul
EUR 252

CCL16 Antibody

1-CSB-PA08967A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

CCL16 Antibody

1-CSB-PA940582
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

CCL16 Antibody

DF9912 200ul
EUR 304
Description: CCL16 Antibody detects endogenous levels of total CCL16.

CCL16 Antibody

1-CSB-PA169235
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CCL16 antibody

70R-7847 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CCL16 antibody

CCL16 Antibody

ABD9912 100 ug
EUR 438

Rabbit CCL16 ELISA Kit

ERTC0607 96Tests
EUR 521

CCL16 Polyclonal Antibody, HRP Conjugated

A55424 100 µg
EUR 570.55
Description: Ask the seller for details

CCL16 Polyclonal Antibody, FITC Conjugated

A55425 100 µg
EUR 570.55
Description: The best epigenetics products

CCL16 Polyclonal Antibody, Biotin Conjugated

A55426 100 µg
EUR 570.55
Description: kits suitable for this type of research

Anti-CCL16 Antibody

A07545-1 100ug/vial
EUR 294

CCL16 Conjugated Antibody

C37464 100ul
EUR 397

CCL16 Conjugated Antibody

C46941 100ul
EUR 397

Anti-CCL16 antibody

STJ117512 100 µl
EUR 277
Description: This gene is one of several cytokine genes clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for lymphocytes and monocytes but not for neutrophils. This cytokine also shows a potent myelosuppressive activity and suppresses proliferation of myeloid progenitor cells. The expression of this gene is upregulated by IL-10.

Anti-CCL16 antibody

STJ191423 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CCL16

CCL16 protein

30R-2577 20 ug
EUR 302
Description: Purified recombinant Human CCL16 protein

CCL16 siRNA

20-abx910758
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCL16 Antibody, HRP conjugated

1-CSB-PA08967B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCL16 Antibody, FITC conjugated

1-CSB-PA08967C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCL16 Antibody, Biotin conjugated

1-CSB-PA08967D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CCL16 Blocking Peptide

33R-5134 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCL16 antibody, catalog no. 70R-10494

CCL16 Blocking Peptide

33R-8609 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCL16 antibody, catalog no. 70R-7847

CCL16, human recombinant

4349-1000
EUR 4617

CCL16, human recombinant

4349-20
EUR 256

CCL16 Blocking Peptide

DF9912-BP 1mg
EUR 195

CCL16 cloning plasmid

CSB-CL004779HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 363
  • Sequence: ATGAAGGTCTCCGAGGCTGCCCTGTCTCTCCTTGTCCTCATCCTTATCATTACTTCGGCTTCTCGCAGCCAGCCAAAAGTTCCTGAGTGGGTGAACACCCCATCCACCTGCTGCCTGAAGTATTATGAGAAAGTGTTGCCAAGGAGACTAGTGGTGGGATACAGAAAGGCCCTCAA
  • Show more
Description: A cloning plasmid for the CCL16 gene.

Anti-LEC/CCL16/HCC4 antibody

STJ16100997 100 µg
EUR 354

Human CCL16 ELISA Kit

ELA-E0138h 96 Tests
EUR 824

Human CCL16 ELISA Kit

EHC0607 96Tests
EUR 521

Goat CCL16 ELISA Kit

EGTC0607 96Tests
EUR 521

Bovine CCL16 ELISA Kit

EBC0607 96Tests
EUR 521

Canine CCL16 ELISA Kit

ECC0607 96Tests
EUR 521

Anserini CCL16 ELISA Kit

EAC0607 96Tests
EUR 521

CCL16 ELISA KIT|Human

EF000046 96 Tests
EUR 689

Human CCL16 shRNA Plasmid

20-abx954293
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HCC-4/CCL16, Human

HY-P7197 50ug
EUR 533

Mouse CCL16 ELISA Kit

EMC0607 96Tests
EUR 521

Rat CCL16 ELISA Kit

ERC0607 96Tests
EUR 521

Porcine CCL16 ELISA Kit

EPC0607 96Tests
EUR 521

Chemokine C-C-Motif Ligand 16 (CCL16) Polyclonal Antibody (Human)

4-PAB126Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL16 (Ala20~Gln120)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 16 (CCL16)

Chemokine C-C-Motif Ligand 16 (CCL16) Polyclonal Antibody (Human)

4-PAB126Hu02
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL16 (Ala20~Gln120)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 16 (CCL16)

Chemokine C-C-Motif Ligand 16 (CCL16) Polyclonal Antibody (Human), APC

4-PAB126Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL16 (Ala20~Gln120)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 16 (CCL16). This antibody is labeled with APC.

Chemokine C-C-Motif Ligand 16 (CCL16) Polyclonal Antibody (Human), Biotinylated

4-PAB126Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL16 (Ala20~Gln120)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 16 (CCL16). This antibody is labeled with Biotin.

Chemokine C-C-Motif Ligand 16 (CCL16) Polyclonal Antibody (Human), Cy3

4-PAB126Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL16 (Ala20~Gln120)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 16 (CCL16). This antibody is labeled with Cy3.

Chemokine C-C-Motif Ligand 16 (CCL16) Polyclonal Antibody (Human), FITC

4-PAB126Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL16 (Ala20~Gln120)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 16 (CCL16). This antibody is labeled with FITC.

Chemokine C-C-Motif Ligand 16 (CCL16) Polyclonal Antibody (Human), HRP

4-PAB126Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL16 (Ala20~Gln120)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 16 (CCL16). This antibody is labeled with HRP.

Chemokine C-C-Motif Ligand 16 (CCL16) Polyclonal Antibody (Human), PE

4-PAB126Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL16 (Ala20~Gln120)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 16 (CCL16). This antibody is labeled with PE.

Chemokine C-C-Motif Ligand 16 (CCL16) Polyclonal Antibody (Human), APC

4-PAB126Hu02-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL16 (Ala20~Gln120)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 16 (CCL16). This antibody is labeled with APC.

Chemokine C-C-Motif Ligand 16 (CCL16) Polyclonal Antibody (Human), Biotinylated

4-PAB126Hu02-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL16 (Ala20~Gln120)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 16 (CCL16). This antibody is labeled with Biotin.

Chemokine C-C-Motif Ligand 16 (CCL16) Polyclonal Antibody (Human), Cy3

4-PAB126Hu02-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL16 (Ala20~Gln120)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 16 (CCL16). This antibody is labeled with Cy3.

Chemokine C-C-Motif Ligand 16 (CCL16) Polyclonal Antibody (Human), FITC

4-PAB126Hu02-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL16 (Ala20~Gln120)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 16 (CCL16). This antibody is labeled with FITC.

Chemokine C-C-Motif Ligand 16 (CCL16) Polyclonal Antibody (Human), HRP

4-PAB126Hu02-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL16 (Ala20~Gln120)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 16 (CCL16). This antibody is labeled with HRP.

Chemokine C-C-Motif Ligand 16 (CCL16) Polyclonal Antibody (Human), PE

4-PAB126Hu02-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL16 (Ala20~Gln120)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 16 (CCL16). This antibody is labeled with PE.

LEC / NCC-4 (CCL16) Protein

20-abx260667
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Guinea Pig CCL16 ELISA Kit

EGC0607 96Tests
EUR 521

CCL16 ORF Vector (Human) (pORF)

ORF012614 1.0 ug DNA
EUR 354

Recombinant Human LEC (CCL16) Protein

PROTO15467-1 20ug
EUR 317
Description: LEC is a CC chemokine that can signal through the CCR8 and CCR1 receptors. It is expressed in the liver, spleen, and thymus. LEC is chemotactic towards monocytes and lymphocytes but not neutrophils. Recombinant human LEC is an 11.2 kDa protein containing 97 amino acid residues, including the four conserved cysteine residues present in CC chemokines.

CCL16 ELISA Kit (Human) (OKCD07165)

OKCD07165 96 Wells
EUR 975
Description: Description of target: CCL16 gene is one of several cytokine genes clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. CCL16 displays chemotactic activity for lymphocytes and monocytes but not for neutrophils. This cytokine also shows a potent myelosuppressive activity and suppresses proliferation of myeloid progenitor cells. The expression of this gene is upregulated by IL-10. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.066ng/mL

Chemokine C-C-Motif Ligand 16 (CCL16) Polyclonal Antibody (Human), APC-Cy7

4-PAB126Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL16 (Ala20~Gln120)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 16 (CCL16). This antibody is labeled with APC-Cy7.

Chemokine C-C-Motif Ligand 16 (CCL16) Polyclonal Antibody (Human), APC-Cy7

4-PAB126Hu02-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL16 (Ala20~Gln120)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 16 (CCL16). This antibody is labeled with APC-Cy7.

Chemokine C-C-Motif Ligand 16 (CCL16) Antibody

20-abx175794
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Chemokine C-C-Motif Ligand 16 (CCL16) Antibody

20-abx211267
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chemokine C-C-Motif Ligand 16 (CCL16) Antibody

20-abx210254
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chemokine C-C-Motif Ligand 16 (CCL16) Antibody

20-abx103117
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Chemokine C-C-Motif Ligand 16 (CCL16) Antibody

20-abx128558
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Chemokine C-C-Motif Ligand 16 (CCL16) Antibody

20-abx109619
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Human LEC/NCC-4 (CCL16)

7-01792 5µg Ask for price

Recombinant Human LEC/NCC-4 (CCL16)

7-01793 20µg Ask for price

Recombinant Human LEC/NCC-4 (CCL16)

7-01794 1mg Ask for price

HCC‑4/CCL16 (CHO-expressed), Human

HY-P7196 10ug
EUR 234

CCL16 sgRNA CRISPR Lentivector set (Human)

K0389901 3 x 1.0 ug
EUR 339

Rabbit Chemokine C-C-Motif Ligand 16 / HCC-4 (CCL16) ELISA Kit

abx363538-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chemokine C-C-Motif Ligand 16 (CCL16) Antibody (Biotin)

20-abx105233
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chemokine C-C-Motif Ligand 16 (CCL16) Antibody (FITC)

20-abx106651
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chemokine C-C-Motif Ligand 16 (CCL16) Antibody (HRP)

20-abx108068
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chemokine C-C-Motif Ligand 16 (CCL16) Antibody (Biotin)

20-abx272472
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Chemokine C-C-Motif Ligand 16 (CCL16) Antibody Pair

20-abx370808
  • EUR 1748.00
  • EUR 1121.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Human C-C motif chemokine 16 (CCL16)

1-CSB-EP004779HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 27.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human C-C motif chemokine 16(CCL16) expressed in E.coli

ELISA kit for Human CCL16/HCC-4

EK5486 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human CCL16/HCC-4 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CCL16/HCC-4 PicoKine ELISA Kit

EK1127 96 wells
EUR 425
Description: For quantitative detection of human CCL16 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

CCL16 sgRNA CRISPR Lentivector (Human) (Target 1)

K0389902 1.0 ug DNA
EUR 154

CCL16 sgRNA CRISPR Lentivector (Human) (Target 2)

K0389903 1.0 ug DNA
EUR 154

CCL16 sgRNA CRISPR Lentivector (Human) (Target 3)

K0389904 1.0 ug DNA
EUR 154

CCL16 LEC/NCC-4 Human Recombinant Protein

PROTO15467 Regular: 20ug
EUR 317
Description: CCL16 Human Recombinant produced in E.Coli is a non-glycosylated, Polypeptide chain containing 97 amino acids and having a molecular mass of 11.2 kDa. ;The CCL16 is purified by proprietary chromatographic techniques.

CCL16 Protein Vector (Human) (pPB-C-His)

PV050453 500 ng
EUR 481

CCL16 Protein Vector (Human) (pPB-N-His)

PV050454 500 ng
EUR 481

CCL16 Protein Vector (Human) (pPM-C-HA)

PV050455 500 ng
EUR 481

CCL16 Protein Vector (Human) (pPM-C-His)

PV050456 500 ng
EUR 481

HCC-4, LEC, NCC-4, CCL16, human

RC315-27 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

CCL16 3'UTR GFP Stable Cell Line

TU053761 1.0 ml
EUR 1394

CCL16 3'UTR Luciferase Stable Cell Line

TU003761 1.0 ml
EUR 1394

CCL16/HCC-4 ELISA Kit (Human) (OKBB00503)

OKBB00503 96 Wells
EUR 505
Description: Description of target: Chemokine (C-C motif) ligand 16 (CCL16) is a small cytokine belonging to the CC chemokine family that is known under several pseudonyms, including Liver-expressed chemokine (LEC) and Monotactin-1 (MTN-1). This chemokine is expressed by the liver, thymus, and spleen and is chemoattractive for monocytes and lymphocytes. Cellular expression of CCL16 can be strongly induced in monocytes by IL-10, IFN-γ and bacterial lipopolysaccharide. Its gene is located on chromosome 17, in humans, among a cluster of other CC chemokines. CCL16 elicits its effects on cells by interacting with cell surface chemokine receptors such as CCR1, CCR2, CCR5 and CCR8.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

CCL16 ELISA Kit (Human) : 96 Wells (OKEH00230)

OKEH00230 96 Wells
EUR 662
Description: Description of target: Shows chemotactic activity for lymphocytes and monocytes but not neutrophils. Also shows potent myelosuppressive activity, suppresses proliferation of myeloid progenitor cells. Recombinant SCYA16 shows chemotactic activity for monocytes and THP-1 monocytes, but not for resting lymphocytes and neutrophils. Induces a calcium flux in THP-1 cells that were desensitized by prior expression to RANTES.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 35 pg/mL

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

CCL16 Rabbit Polyclonal Antibody