CCL25 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

CCL25 Polyclonal Antibody

ES10267-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CCL25 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCL25 Polyclonal Antibody

ABP58014-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of CCL25 from Human, Mouse. This CCL25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110

CCL25 Polyclonal Antibody

ABP58014-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of CCL25 from Human, Mouse. This CCL25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110

CCL25 Polyclonal Antibody

ABP58014-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of CCL25 from Human, Mouse. This CCL25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110

Ccl25 Polyclonal Antibody

A53085 100 µg
EUR 570.55
Description: kits suitable for this type of research

CCL25 Rabbit pAb

A2685-100ul 100 ul
EUR 308

CCL25 Rabbit pAb

A2685-200ul 200 ul
EUR 459

CCL25 Rabbit pAb

A2685-20ul 20 ul
EUR 183

CCL25 Rabbit pAb

A2685-50ul 50 ul
EUR 223

CCL25 Rabbit pAb

A6543-100ul 100 ul
EUR 308

CCL25 Rabbit pAb

A6543-200ul 200 ul
EUR 459

CCL25 Rabbit pAb

A6543-20ul 20 ul
EUR 183

CCL25 Rabbit pAb

A6543-50ul 50 ul
EUR 223

CCL25 antibody

38996-100ul 100ul
EUR 252

CCL25 Antibody

42700-100ul 100ul
EUR 252

CCL25 Antibody

1-CSB-PA004789ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCL25. Recognizes CCL25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Ccl25 Antibody

1-CSB-PA09189A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ccl25. Recognizes Ccl25 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

CCL25 Antibody

1-CSB-PA118672
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCL25. Recognizes CCL25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

Ccl25 Polyclonal Antibody, Biotin Conjugated

A53082 100 µg
EUR 570.55
Description: The best epigenetics products

Ccl25 Polyclonal Antibody, FITC Conjugated

A53083 100 µg
EUR 570.55
Description: kits suitable for this type of research

Ccl25 Polyclonal Antibody, HRP Conjugated

A53084 100 µg
EUR 570.55
Description: fast delivery possible

CCL25 Conjugated Antibody

C38996 100ul
EUR 397

Anti-CCL25 antibody

STJ28626 100 µl
EUR 277
Description: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants.

Anti-CCL25 antibody

STJ116184 100 µl
EUR 277
Description: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants.

Anti-CCL25 antibody

STJ191425 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CCL25

CCL25 siRNA

20-abx910776
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCL25 siRNA

20-abx910777
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti- CCL25/TECK antibody

FNab01381 100µg
EUR 505.25
  • Immunogen: chemokine(C-C motif) ligand 25
  • Uniprot ID: O15444
  • Gene ID: 6370
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against CCL25/TECK

Ccl25 Antibody, HRP conjugated

1-CSB-PA09189B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ccl25. Recognizes Ccl25 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Ccl25 Antibody, FITC conjugated

1-CSB-PA09189C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ccl25. Recognizes Ccl25 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Ccl25 Antibody, Biotin conjugated

1-CSB-PA09189D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ccl25. Recognizes Ccl25 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-CCL25/TECK antibody

PAab01381 100 ug
EUR 355

CCL25 cloning plasmid

CSB-CL004789HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 453
  • Sequence: atgaacctgtggctcctggcctgcctggtggccggcttcctgggagcctgggcccccgctgtccacacccaaggtgtctttgaggactgctgcctggcctaccactaccccattgggtgggctgtgctccggcgcgcctggacttaccggatccaggaggtgagcgggagctgcaa
  • Show more
Description: A cloning plasmid for the CCL25 gene.

TECK/CCL25, Human

HY-P7294 50ug
EUR 497

TECK, CCL25, human

RC315-36 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

CCL25, murine (mouse)

RC335-36 5ug
EUR 101.33
  • Product category: Proteins/Recombinant Proteins/Cytokines

Thymus Expressed Chemokine (CCL25) Antibody

abx231381-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Rabbit Thymus Expressed Chemokine / TECK (CCL25) ELISA Kit

abx363170-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human CCL25 ELISA Kit

ELA-E1248h 96 Tests
EUR 824

CCL25 ELISA KIT|Human

EF000124 96 Tests
EUR 689

Canine CCL25 ELISA KIT

ELI-04127d 96 Tests
EUR 928

Human CCL25 shRNA Plasmid

20-abx954302
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CCL25 protein (His tag)

80R-4131 100 ug
EUR 327
Description: Recombinant Human CCL25 protein (His tag)

TECK (CCL25), human recombinant

7214-10
EUR 207

TECK (CCL25), human recombinant

7214-50
EUR 675

Mouse CCL25 shRNA Plasmid

20-abx972601
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

C-C Motif Chemokine 25 (CCL25) Antibody

20-abx005022
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-C Motif Chemokine 25 (CCL25) Antibody

20-abx005616
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-C Motif Chemokine 25 (CCL25) Antibody

20-abx320184
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-C Motif Chemokine 25 (CCL25) Antibody

abx412122-01mg 0.1 mg
EUR 704
  • Shipped within 1 week.

Recombinant Human TECK (CCL25) Protein

PROTO15444-2 20ug
EUR 317
Description: TECK is a CC chemokine, specifically expressed by thymic stromal cells, and signals through the CCR9 receptor. TECK is chemotactic towards activated macrophages, thymocytes and dendritic cells. Recombinant human TECK is a 14.2 kDa protein containing 127 amino acid residues, including the four conserved cysteine residues present in CC chemokines.

Ccl25 ORF Vector (Mouse) (pORF)

ORF040692 1.0 ug DNA
EUR 506

CCL25 ORF Vector (Human) (pORF)

ORF012615 1.0 ug DNA
EUR 354

Ccl25 ORF Vector (Rat) (pORF)

ORF064552 1.0 ug DNA
EUR 506

CCL25 ELISA Kit (Human) (OKAN06540)

OKAN06540 96 Wells
EUR 792
Description: Description of target: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 11.5 pg/mL

Ccl25 ELISA Kit (Mouse) (OKBB00980)

OKBB00980 96 Wells
EUR 505
Description: Description of target: Chemokine (C-C motif) ligand 25 (CCL25) is a small cytokine belonging to the CC chemokine family that is also known as TECK (Thymus-Expressed Chemokine). The mouse Teck gene was mapped to chromosome 8 and human Teck gene was to 19p13.2. CCL25 is believed to play a role in the development of T-cells. It is chemotactic for thymocytes, macrophages, and dendritic cells. CCL25 elicits its effects by binding to the chemokine receptor CCR9.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

CCL25 ELISA Kit (Human) (OKCD07248)

OKCD07248 96 Wells
EUR 936
Description: Description of target: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 11.5pg/mL

Ccl25 ELISA Kit (Mouse) (OKEH04673)

OKEH04673 96 Wells
EUR 662
Description: Description of target: Potentially involved in T-cell development. Recombinant protein shows chemotactic activity on thymocytes, macrophages, THP-1 cells, and dendritics cells but is inactive on peripheral blood lymphocytes and neutrophils. Binds to CCR9. Binds to atypical chemokine receptor ACKR4 and mediates the recruitment of beta-arrestin (ARRB1/2) to ACKR4.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

CCL25 ELISA Kit (Human) (OKEH04674)

OKEH04674 96 Wells
EUR 662
Description: Description of target: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 32 pg/mL

CCL25 ELISA Kit (Pig) (OKEH06336)

OKEH06336 96 Wells
EUR 779
Description: Description of target: Potentially involved in T-cell development. Recombinant protein shows chemotactic activity on thymocytes, macrophages, THP-1 cells, and dendritics cells but is inactive on peripheral blood lymphocytes and neutrophils. Binds to CCR9. Binds to atypical chemokine receptor ACKR4 and mediates the recruitment of beta-arrestin (ARRB1/2) to ACKR4.;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.069 ng/mL

CCL25 ELISA Kit (Rat) (OKEI00859)

OKEI00859 96 Wells
EUR 767
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.75 pg/mL

C-C Motif Chemokine Ligand 25 (CCL25) Antibody

20-abx109626
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

C-C Motif Chemokine Ligand 25 (CCL25) Antibody

20-abx210507
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse CCL25/TECK PicoKine ELISA Kit

EK1424 96 wells
EUR 425
Description: For quantitative detection of mouse CCL25 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

ELISA kit for Mouse CCL25/TECK

EK5665 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CCL25/TECK in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CCL25/TECK PicoKine ELISA Kit

EK1145 96 wells
EUR 425
Description: For quantitative detection of human CCL25 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

CCL25 sgRNA CRISPR Lentivector set (Human)

K0390801 3 x 1.0 ug
EUR 339

Recombinant Human Thymus Expressed Chemokine (CCL25)

7-02125 5µg Ask for price

Recombinant Human Thymus Expressed Chemokine (CCL25)

7-02126 20µg Ask for price

Recombinant Human Thymus Expressed Chemokine (CCL25)

7-02127 1mg Ask for price

Recombinant Mouse Thymus Expressed Chemokine (CCL25)

7-02128 5µg Ask for price

Recombinant Mouse Thymus Expressed Chemokine (CCL25)

7-02129 20µg Ask for price

Recombinant Mouse Thymus Expressed Chemokine (CCL25)

7-02130 1mg Ask for price

Ccl25 sgRNA CRISPR Lentivector set (Mouse)

K3914601 3 x 1.0 ug
EUR 339

Ccl25 sgRNA CRISPR Lentivector set (Rat)

K7193801 3 x 1.0 ug
EUR 339

C-C Motif Chemokine Ligand 25 (CCL25) Antibody (Biotin)

20-abx105239
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

C-C Motif Chemokine Ligand 25 (CCL25) Antibody (FITC)

20-abx106657
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

C-C Motif Chemokine Ligand 25 (CCL25) Antibody (HRP)

20-abx108074
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CCL25 sgRNA CRISPR Lentivector (Human) (Target 1)

K0390802 1.0 ug DNA
EUR 154

CCL25 sgRNA CRISPR Lentivector (Human) (Target 2)

K0390803 1.0 ug DNA
EUR 154

CCL25 sgRNA CRISPR Lentivector (Human) (Target 3)

K0390804 1.0 ug DNA
EUR 154

Mouse C-C motif chemokine 25 (Ccl25)

1-CSB-RP091894m
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 18 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse C-C motif chemokine 25(Ccl25),partial expressed in E.coli

Human C-C motif chemokine 25 (CCL25)

1-CSB-EP004789HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 41.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human C-C motif chemokine 25(CCL25) expressed in E.coli

Ccl25 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3914602 1.0 ug DNA
EUR 154

Ccl25 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3914603 1.0 ug DNA
EUR 154

Ccl25 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3914604 1.0 ug DNA
EUR 154

Ccl25 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7193802 1.0 ug DNA
EUR 154

Ccl25 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7193803 1.0 ug DNA
EUR 154

Ccl25 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7193804 1.0 ug DNA
EUR 154

CCL25 Protein Vector (Human) (pPB-C-His)

PV050457 500 ng
EUR 481

CCL25 Protein Vector (Human) (pPB-N-His)

PV050458 500 ng
EUR 481

CCL25 Protein Vector (Human) (pPM-C-HA)

PV050459 500 ng
EUR 481

CCL25 Protein Vector (Human) (pPM-C-His)

PV050460 500 ng
EUR 481

CCL25 Protein Vector (Rat) (pPB-C-His)

PV258206 500 ng
EUR 603

CCL25 Protein Vector (Rat) (pPB-N-His)

PV258207 500 ng
EUR 603

CCL25 Protein Vector (Rat) (pPM-C-HA)

PV258208 500 ng
EUR 603

CCL25 Protein Vector (Rat) (pPM-C-His)

PV258209 500 ng
EUR 603

CCL25 Protein Vector (Mouse) (pPB-C-His)

PV162766 500 ng
EUR 603

CCL25 Protein Vector (Mouse) (pPB-N-His)

PV162767 500 ng
EUR 603

CCL25 Protein Vector (Mouse) (pPM-C-HA)

PV162768 500 ng
EUR 603

CCL25 Protein Vector (Mouse) (pPM-C-His)

PV162769 500 ng
EUR 603

Ccl25 3'UTR Luciferase Stable Cell Line

TU201867 1.0 ml Ask for price

Ccl25 3'UTR GFP Stable Cell Line

TU153379 1.0 ml Ask for price

CCL25 3'UTR Luciferase Stable Cell Line

TU003770 1.0 ml
EUR 1394

Ccl25 3'UTR Luciferase Stable Cell Line

TU103379 1.0 ml Ask for price

CCL25 3'UTR GFP Stable Cell Line

TU053770 1.0 ml
EUR 1394

Ccl25 3'UTR GFP Stable Cell Line

TU251867 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CCL25 Rabbit Polyclonal Antibody