CCL28 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

CCL28 Polyclonal Antibody

ABP58015-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CCL28 protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of CCL28 from Human, Mouse. This CCL28 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL28 protein at amino acid sequence of 50-130

CCL28 Polyclonal Antibody

ABP58015-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CCL28 protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of CCL28 from Human, Mouse. This CCL28 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL28 protein at amino acid sequence of 50-130

CCL28 Rabbit pAb

A2596-100ul 100 ul
EUR 308

CCL28 Rabbit pAb

A2596-200ul 200 ul
EUR 459

CCL28 Rabbit pAb

A2596-20ul 20 ul
EUR 183

CCL28 Rabbit pAb

A2596-50ul 50 ul
EUR 223

CCL28 Antibody

ABD7045 100 ug
EUR 438

CCL28 Antibody

32743-100ul 100ul
EUR 252

CCL28 antibody

70R-16226 50 ul
EUR 435
Description: Rabbit polyclonal CCL28 antibody

CCL28 Antibody

DF7045 200ul
EUR 304
Description: CCL28 Antibody detects endogenous levels of total CCL28.

CCL28 Antibody

1-CSB-PA975229
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

CCL28 Antibody

1-CSB-PA868302ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

CCL28 Antibody

1-CSB-PA868302ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CCL28 Antibody

1-CSB-PA004792GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CCL28

E21-095 10ug
EUR 343

CCL28 Conjugated Antibody

C32743 100ul
EUR 397

anti- CCL28 antibody

FNab01383 100µg
EUR 505.25
  • Immunogen: chemokine(C-C motif) ligand 28
  • Uniprot ID: Q9NRJ3
  • Gene ID: 56477
  • Research Area: Immunology
Description: Antibody raised against CCL28

Anti-CCL28 antibody

PAab01383 100 ug
EUR 355

Anti-CCL28 antibody

STJ22934 100 µl
EUR 277
Description: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for resting CD4 or CD8 T cells and eosinophils. The product of this gene binds to chemokine receptors CCR3 and CCR10. This chemokine may play a role in the physiology of extracutaneous epithelial tissues, including diverse mucosal organs. Multiple transcript variants encoding two different isoforms have been found for this gene.

Anti-CCL28 antibody

STJ191426 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CCL28

CCL28 siRNA

20-abx910782
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCL28 siRNA

20-abx910783
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CCL28

YF-PA20001 50 ul
EUR 363
Description: Mouse polyclonal to CCL28

anti-CCL28

YF-PA20002 50 ug
EUR 363
Description: Mouse polyclonal to CCL28

MEC/CCL28, Human

HY-P7250 10ug
EUR 268

MEC/CCL28, Mouse

HY-P7251 50mg
EUR 533

MEC/CCL28, Rat

HY-P7252 10mg
EUR 268

CCL28 cloning plasmid

CSB-CL868302HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 384
  • Sequence: atgcagcagagaggactcgccatcgtggccttggctgtctgtgcggccctacatgcctcagaagccatacttcccattgcctccagctgttgcacggaggtttcacatcatatttccagaaggctcctggaaagagtgaatatgtgtcgcatccagagagctgatggggattgtga
  • Show more
Description: A cloning plasmid for the CCL28 gene.

CCL28 Blocking Peptide

DF7045-BP 1mg
EUR 195

MEC, CCL28, human

RC315-39 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

MEC, CCL28, rat

RC355-39 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Mouse CCL28 shRNA Plasmid

20-abx974920
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CCL28 ELISA Kit

ELA-E1573h 96 Tests
EUR 824

Canine CCL28 ELISA KIT

ELI-05166d 96 Tests
EUR 928

CCL28 ELISA KIT|Human

EF000436 96 Tests
EUR 689

CCL28 protein (His tag)

80R-1194 100 ug
EUR 397
Description: Purified recombinant Human CCL28 protein

MEC/CCL28, human recombinant

7170-10
EUR 207

MEC/CCL28, human recombinant

7170-50
EUR 675

MEC/CCL28, murine recombinant

7171-10
EUR 207

MEC/CCL28, murine recombinant

7171-50
EUR 675

Human CCL28 shRNA Plasmid

20-abx961142
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CCL28 ELISA Kit

LF-EK50878 1×96T
EUR 648

MEC, CCL28, murine (mouse)

RC335-39 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

C-C Motif Chemokine 28 (CCL28) Antibody

20-abx111573
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-C Motif Chemokine 28 (CCL28) Antibody

20-abx002030
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-C Motif Chemokine 28 (CCL28) Antibody

20-abx320153
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-C Motif Chemokine 28 (CCL28) Antibody

20-abx322240
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-C Motif Chemokine 28 (CCL28) Antibody

20-abx225078
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-C Motif Chemokine 28 (CCL28) Antibody

abx231383-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Rabbit C-C Motif Chemokine 28 / MEC (CCL28) ELISA Kit

abx362876-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Human CCL28

EK5277 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human CCL28 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse CCL28

EK5278 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CCL28 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CCL28 PicoKine ELISA Kit

EK0690 96 wells
EUR 425
Description: For quantitative detection of human CCL28 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Mouse CCL28 PicoKine ELISA Kit

EK0691 96 wells
EUR 425
Description: For quantitative detection of mouse CCL28 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Mouse CCL28 Detection Assay Kit

6724 1 kit
EUR 483.55
Description: Mouse CCL28 Detection Assay Kit

CCL28 ORF Vector (Human) (pORF)

ORF002044 1.0 ug DNA
EUR 95

Recombinant Murine MEC (CCL28) Protein

PROTQ9JIL2-1 20ug
EUR 317
Description: MEC is a secreted CC chemokine expressed primarily by epithelial cells of the bronchioles, salivary gland, mammary gland and colon. MEC signals through the CCR10 receptor and chemoattracts resting CD4, CD8 T-cells and eosinophils. MEC contains six cysteines including the four highly conserved cysteine residues present in CC chemokines. Recombinant murine MEC is a 12.6 kDa protein containing 111 amino acid residues.

Recombinant Human MEC (CCL28) Protein

PROTQ9NRJ3-2 20ug
EUR 317
Description: MEC is a secreted CC chemokine expressed primarily by epithelial cells of the bronchioles, salivary gland, mammary gland and colon. MEC signals through the CCR10 receptor and chemoattracts resting CD4, CD8 T-cells and eosinophils. MEC contains six cysteines including the four highly conserved cysteine residues present in CC chemokines. Recombinant human MEC is a 12.3 kDa protein containing 108 amino acid residues.

Ccl28 ORF Vector (Mouse) (pORF)

ORF040701 1.0 ug DNA
EUR 506

Ccl28 ORF Vector (Rat) (pORF)

ORF064555 1.0 ug DNA
EUR 506

CCL28 ELISA Kit (Human) (OKAN04990)

OKAN04990 96 Wells
EUR 792
Description: Description of target: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for resting CD4 or CD8 T cells and eosinophils. The product of this gene binds to chemokine receptors CCR3 and CCR10. This chemokine may play a role in the physiology of extracutaneous epithelial tissues, including diverse mucosal organs. Multiple transcript variants encoding two different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059 ng/mL

CCL28 ELISA Kit (Mouse) (OKBB00419)

OKBB00419 96 Wells
EUR 505
Description: Description of target: CCL28, also known as mucosae-associated epithelial chemokine (MEC), CCK1 and SCYA28, is a chemokine. It is mapped to 5p12. The tumor hypoxia promotes the recruitment of regulatory T (Treg) cells through induction of expression of the chemokine CCL28, which in turn promotes tumor tolerance and angiogenesis. CCL28 regulates the chemotaxis of cells that express the chemokine receptors CCR3 and CCR10. CCL28 has also been implicated in the migration of IgA-expressing cells to the mammary gland, salivary gland, intestine and other mucosal tissues. It has also been shown as a potential antimicrobial agent effective against certain pathogens, such as Gram negative and Gram positive bacteria and the fungus Candida albicans.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

CCL28 ELISA Kit (Human) (OKBB00781)

OKBB00781 96 Wells
EUR 505
Description: Description of target: CCL28, also known as mucosae-associated epithelial chemokine (MEC), CCK1 and SCYA28, is a chemokine. It is mapped to 5p12. The tumor hypoxia promotes the recruitment of regulatory T (Treg) cells through induction of expression of the chemokine CCL28, which in turn promotes tumor tolerance and angiogenesis. CCL28 regulates the chemotaxis of cells that express the chemokine receptors CCR3 and CCR10. CCL28 has also been implicated in the migration of IgA-expressing cells to the mammary gland, salivary gland, intestine and other mucosal tissues. It has also been shown as a potential antimicrobial agent effective against certain pathogens, such as Gram negative and Gram positive bacteria and the fungus Candida albicans. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

CCL28 ELISA Kit (Human) (OKCD07504)

OKCD07504 96 Wells
EUR 936
Description: Description of target: Recombinant Human Mucosae-Associated Epithelial Chemokine (CCL28);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

C-C Motif Chemokine Ligand 28 (CCL28) Antibody

20-abx211316
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CCL28 sgRNA CRISPR Lentivector set (Human)

K0391101 3 x 1.0 ug
EUR 339

Ccl28 sgRNA CRISPR Lentivector set (Mouse)

K4382301 3 x 1.0 ug
EUR 339

Ccl28 sgRNA CRISPR Lentivector set (Rat)

K7127101 3 x 1.0 ug
EUR 339

CCL28 sgRNA CRISPR Lentivector (Human) (Target 1)

K0391102 1.0 ug DNA
EUR 154

CCL28 sgRNA CRISPR Lentivector (Human) (Target 2)

K0391103 1.0 ug DNA
EUR 154

CCL28 sgRNA CRISPR Lentivector (Human) (Target 3)

K0391104 1.0 ug DNA
EUR 154

Recombinant Human Mucosae-Associated Epithelial Chemokine (CCL28)

7-01993 5µg Ask for price

Recombinant Human Mucosae-Associated Epithelial Chemokine (CCL28)

7-01994 20µg Ask for price

Recombinant Human Mucosae-Associated Epithelial Chemokine (CCL28)

7-01995 1mg Ask for price

Recombinant Mouse Mucosae-Associated Epithelial Chemokine (CCL28)

7-01999 5µg Ask for price

Recombinant Mouse Mucosae-Associated Epithelial Chemokine (CCL28)

7-02000 20µg Ask for price

Recombinant Mouse Mucosae-Associated Epithelial Chemokine (CCL28)

7-02001 1mg Ask for price

Ccl28 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4382302 1.0 ug DNA
EUR 154

Ccl28 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4382303 1.0 ug DNA
EUR 154

Ccl28 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4382304 1.0 ug DNA
EUR 154

Ccl28 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7127102 1.0 ug DNA
EUR 154

Ccl28 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7127103 1.0 ug DNA
EUR 154

Ccl28 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7127104 1.0 ug DNA
EUR 154

Recombinant Human CCL28 Protein, Untagged, E.coli-100ug

QP10243-ec-100ug 100ug
EUR 988

Recombinant Human CCL28 Protein, Untagged, E.coli-20ug

QP10243-ec-20ug 20ug
EUR 290

Recombinant Human CCL28 Protein, Untagged, E.coli-250ug

QP10243-ec-250ug 250ug
EUR 1731

Recombinant Human CCL28 Protein, Untagged, E.coli-5ug

QP10243-ec-5ug 5ug
EUR 154

Recombinant Mouse CCL28 Protein, Untagged, E.coli-100ug

QP10250-ec-100ug 100ug
EUR 1178

Recombinant Mouse CCL28 Protein, Untagged, E.coli-20ug

QP10250-ec-20ug 20ug
EUR 290

Recombinant Mouse CCL28 Protein, Untagged, E.coli-250ug

QP10250-ec-250ug 250ug
EUR 2067

Recombinant Mouse CCL28 Protein, Untagged, E.coli-5ug

QP10250-ec-5ug 5ug
EUR 154

Recombinant Rat CCL28 Protein, Untagged, E.coli-100ug

QP10300-ec-100ug 100ug
EUR 1178

Recombinant Rat CCL28 Protein, Untagged, E.coli-20ug

QP10300-ec-20ug 20ug
EUR 290

Recombinant Rat CCL28 Protein, Untagged, E.coli-250ug

QP10300-ec-250ug 250ug
EUR 2067

Recombinant Rat CCL28 Protein, Untagged, E.coli-5ug

QP10300-ec-5ug 5ug
EUR 154

CCL28 Protein Vector (Human) (pPB-C-His)

PV008173 500 ng
EUR 329

CCL28 Protein Vector (Human) (pPB-N-His)

PV008174 500 ng
EUR 329

CCL28 Protein Vector (Human) (pPM-C-HA)

PV008175 500 ng
EUR 329

CCL28 Protein Vector (Human) (pPM-C-His)

PV008176 500 ng
EUR 329

CCL28 Protein Vector (Rat) (pPB-C-His)

PV258218 500 ng
EUR 603

CCL28 Protein Vector (Rat) (pPB-N-His)

PV258219 500 ng
EUR 603

CCL28 Protein Vector (Rat) (pPM-C-HA)

PV258220 500 ng
EUR 603

CCL28 Protein Vector (Rat) (pPM-C-His)

PV258221 500 ng
EUR 603

CCL28 Protein Vector (Mouse) (pPB-C-His)

PV162802 500 ng
EUR 603

CCL28 Protein Vector (Mouse) (pPB-N-His)

PV162803 500 ng
EUR 603

CCL28 Protein Vector (Mouse) (pPM-C-HA)

PV162804 500 ng
EUR 603

CCL28 Protein Vector (Mouse) (pPM-C-His)

PV162805 500 ng
EUR 603

Ccl28 3'UTR Luciferase Stable Cell Line

TU201870 1.0 ml Ask for price

Ccl28 3'UTR GFP Stable Cell Line

TU153383 1.0 ml Ask for price

CCL28 3'UTR Luciferase Stable Cell Line

TU003773 1.0 ml
EUR 1521

Ccl28 3'UTR Luciferase Stable Cell Line

TU103383 1.0 ml Ask for price

CCL28 3'UTR GFP Stable Cell Line

TU053773 1.0 ml
EUR 1521

Ccl28 3'UTR GFP Stable Cell Line

TU251870 1.0 ml Ask for price

CCL28 ELISA Kit (Human) : 96 Wells (OKEH01132)

OKEH01132 96 Wells
EUR 596
Description: Description of target: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for resting CD4 or CD8 T cells and eosinophils. The product of this gene binds to chemokine receptors CCR3 and CCR10. This chemokine may play a role in the physiology of extracutaneous epithelial tissues, including diverse mucosal organs. Multiple transcript variants encoding two different isoforms have been found for this gene. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34 pg/mL

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CCL28 Rabbit Polyclonal Antibody