ELL3 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

ELL3 Polyclonal Antibody

ES10187-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ELL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ELL3 Polyclonal Antibody

ES10187-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ELL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-ELL3 antibody

STJ191345 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ELL3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA21048 50 ul
EUR 363
Description: Mouse polyclonal to ELL3


YF-PA21049 50 ug
EUR 363
Description: Mouse polyclonal to ELL3


YF-PA21050 50 ul
EUR 363
Description: Mouse polyclonal to ELL3


YF-PA21051 50 ug
EUR 363
Description: Mouse polyclonal to ELL3

ELL3 cloning plasmid

CSB-CL864017HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1194
  • Sequence: atggaggagctccaggagcctctgagaggacagctccggctctgcttcacgcaagctgcccggactagcctcttactgctcaggctcaacgacgctgccctgcgggcgctgcaagagtgtcagcggcaacaggtacggccggtgattgctttccaaggccaccgagggtatctga
  • Show more
Description: A cloning plasmid for the ELL3 gene.

Mouse RNA polymerase II elongation factor ELL3, Ell3 ELISA KIT

ELI-27656m 96 Tests
EUR 865

Ell3 ELISA Kit| Mouse RNA polymerase II elongation factor ELL3

EF014772 96 Tests
EUR 689

Human RNA polymerase II elongation factor ELL3, ELL3 ELISA KIT

ELI-47045h 96 Tests
EUR 824


EF004892 96 Tests
EUR 689

Rat ELL3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ELL3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ELL3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ELL3 Recombinant Protein (Human)

RP010579 100 ug Ask for price

ELL3 Recombinant Protein (Rat)

RP199490 100 ug Ask for price

ELL3 Recombinant Protein (Mouse)

RP131516 100 ug Ask for price

Ell3 ORF Vector (Rat) (pORF)

ORF066498 1.0 ug DNA
EUR 506

ELL3 ORF Vector (Human) (pORF)

ORF003527 1.0 ug DNA
EUR 95

Ell3 ORF Vector (Mouse) (pORF)

ORF043840 1.0 ug DNA
EUR 506

ELL3 sgRNA CRISPR Lentivector set (Human)

K0675201 3 x 1.0 ug
EUR 339

Ell3 sgRNA CRISPR Lentivector set (Rat)

K6151701 3 x 1.0 ug
EUR 339

Ell3 sgRNA CRISPR Lentivector set (Mouse)

K4307201 3 x 1.0 ug
EUR 339

Elongation Factor RNA Polymerase II-Like 3 (ELL3) Antibody

abx030154-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Elongation Factor RNA Polymerase II-Like 3 (ELL3) Antibody

abx030154-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ELL3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0675202 1.0 ug DNA
EUR 154

ELL3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0675203 1.0 ug DNA
EUR 154

ELL3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0675204 1.0 ug DNA
EUR 154

Ell3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6151702 1.0 ug DNA
EUR 154

Ell3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6151703 1.0 ug DNA
EUR 154

Ell3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6151704 1.0 ug DNA
EUR 154

Ell3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4307202 1.0 ug DNA
EUR 154

Ell3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4307203 1.0 ug DNA
EUR 154

Ell3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4307204 1.0 ug DNA
EUR 154

ELL3 Protein Vector (Mouse) (pPB-C-His)

PV175358 500 ng
EUR 603

ELL3 Protein Vector (Mouse) (pPB-N-His)

PV175359 500 ng
EUR 603

ELL3 Protein Vector (Mouse) (pPM-C-HA)

PV175360 500 ng
EUR 603

ELL3 Protein Vector (Mouse) (pPM-C-His)

PV175361 500 ng
EUR 603

ELL3 Protein Vector (Rat) (pPB-C-His)

PV265990 500 ng
EUR 603

ELL3 Protein Vector (Rat) (pPB-N-His)

PV265991 500 ng
EUR 603

ELL3 Protein Vector (Rat) (pPM-C-HA)

PV265992 500 ng
EUR 603

ELL3 Protein Vector (Rat) (pPM-C-His)

PV265993 500 ng
EUR 603

ELL3 Protein Vector (Human) (pPB-C-His)

PV014105 500 ng
EUR 329

ELL3 Protein Vector (Human) (pPB-N-His)

PV014106 500 ng
EUR 329

ELL3 Protein Vector (Human) (pPM-C-HA)

PV014107 500 ng
EUR 329

ELL3 Protein Vector (Human) (pPM-C-His)

PV014108 500 ng
EUR 329

Ell3 3'UTR GFP Stable Cell Line

TU155765 1.0 ml Ask for price

Ell3 3'UTR Luciferase Stable Cell Line

TU105765 1.0 ml Ask for price

Ell3 3'UTR Luciferase Stable Cell Line

TU203932 1.0 ml Ask for price

Ell3 3'UTR GFP Stable Cell Line

TU253932 1.0 ml Ask for price

ELL3 3'UTR GFP Stable Cell Line

TU056833 1.0 ml
EUR 1394

ELL3 3'UTR Luciferase Stable Cell Line

TU006833 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

ELL3 Rabbit Polyclonal Antibody