GPM6B Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

GPM6B Polyclonal Antibody

ABP58684-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human GPM6B protein at amino acid sequence of 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of GPM6B from Human, Mouse, Rat. This GPM6B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPM6B protein at amino acid sequence of 450-530

GPM6B Polyclonal Antibody

ABP58684-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GPM6B protein at amino acid sequence of 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of GPM6B from Human, Mouse, Rat. This GPM6B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPM6B protein at amino acid sequence of 450-530

GPM6B Polyclonal Antibody

ABP58684-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GPM6B protein at amino acid sequence of 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of GPM6B from Human, Mouse, Rat. This GPM6B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPM6B protein at amino acid sequence of 450-530

GPM6B Polyclonal Antibody

A64670 100 µg
EUR 570.55
Description: Ask the seller for details

GPM6B Antibody

ABD9700 100 ug
EUR 438

GPM6B Antibody

46094-100ul 100ul
EUR 252

GPM6B Antibody

46094-50ul 50ul
EUR 187

GPM6B Antibody

DF9700 200ul
EUR 304
Description: GPM6B Antibody detects endogenous levels of total GPM6B.

GPM6B Antibody

1-CSB-PA614417LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPM6B. Recognizes GPM6B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

Polyclonal GPM6B Antibody (N-term)

APR12203G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPM6B (N-term). This antibody is tested and proven to work in the following applications:

GPM6B Polyclonal Antibody, HRP Conjugated

A64671 100 µg
EUR 570.55
Description: The best epigenetics products

GPM6B Polyclonal Antibody, FITC Conjugated

A64672 100 µg
EUR 570.55
Description: kits suitable for this type of research

GPM6B Polyclonal Antibody, Biotin Conjugated

A64673 100 µg
EUR 570.55
Description: fast delivery possible

GPM6B Conjugated Antibody

C46094 100ul
EUR 397

Anti-GPM6B antibody

STJ191078 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GPM6B

GPM6B siRNA

20-abx902263
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPM6B siRNA

20-abx918388
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPM6B siRNA

20-abx918389
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPM6B Antibody, HRP conjugated

1-CSB-PA614417LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPM6B. Recognizes GPM6B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GPM6B Antibody, FITC conjugated

1-CSB-PA614417LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPM6B. Recognizes GPM6B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GPM6B Antibody, Biotin conjugated

1-CSB-PA614417LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPM6B. Recognizes GPM6B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GPM6B cloning plasmid

CSB-CL614417HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 918
  • Sequence: atgaagccagccatggaaactgcagccgaggaaaatactgaacaaagccaagagagaaaagtgaacagcagagctgaaatggaaattggcaggtaccactggatgtacccaggctcaaagaaccaccagtaccatcccgtgccaaccctgggggacagggctagccccttgagcag
  • Show more
Description: A cloning plasmid for the GPM6B gene.

GPM6B Blocking Peptide

DF9700-BP 1mg
EUR 195

pCMV-SPORT6-GPM6B

PVT12814 2 ug
EUR 391

Rat GPM6B shRNA Plasmid

20-abx987832
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPM6B ELISA KIT|Human

EF005057 96 Tests
EUR 689

Mouse GPM6B shRNA Plasmid

20-abx970629
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPM6B shRNA Plasmid

20-abx951889
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPM6B Recombinant Protein (Human)

RP013756 100 ug Ask for price

GPM6B Recombinant Protein (Rat)

RP203252 100 ug Ask for price

GPM6B Recombinant Protein (Mouse)

RP139346 100 ug Ask for price

GPM6B Recombinant Protein (Mouse)

RP139349 100 ug Ask for price

GPM6B Recombinant Protein (Mouse)

RP139352 100 ug Ask for price

GPM6B Recombinant Protein (Mouse)

RP139355 100 ug Ask for price

GPM6B Recombinant Protein (Mouse)

RP139358 100 ug Ask for price

GPM6B Recombinant Protein (Mouse)

RP139361 100 ug Ask for price

GPM6B Recombinant Protein (Mouse)

RP139364 100 ug Ask for price

GPM6B Recombinant Protein (Mouse)

RP139367 100 ug Ask for price

GPM6B Recombinant Protein (Mouse)

RP139370 100 ug Ask for price

Neuronal Membrane Glycoprotein M6-B (GPM6B) Antibody

abx026488-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

GPM6B Rabbit Polyclonal Antibody