HCN3 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

HCN3 Polyclonal Antibody
ES10036-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HCN3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
HCN3 Polyclonal Antibody
ES10036-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HCN3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
HCN3 Polyclonal Antibody
ABP58761-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of HCN3 from Human, Mouse, Rat. This HCN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230
HCN3 Polyclonal Antibody
ABP58761-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of HCN3 from Human, Mouse, Rat. This HCN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230
HCN3 Polyclonal Antibody
ABP58761-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of HCN3 from Human, Mouse, Rat. This HCN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230
Polyclonal HCN3 (extracellular) Antibody
APR12352G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HCN3 (extracellular) . This antibody is tested and proven to work in the following applications:
HCN3 Antibody
ABD9770 100 ug
EUR 438
HCN3 antibody
70R-5168 50 ug
EUR 467
Description: Rabbit polyclonal HCN3 antibody raised against the middle region of HCN3
HCN3 Antibody
ABD13116 100 ug
EUR 438
HCN3 Antibody
43682-100ul 100ul
EUR 252
HCN3 antibody
70R-17702 50 ul
EUR 435
Description: Rabbit polyclonal HCN3 antibody
HCN3 Antibody
DF9770 200ul
EUR 304
Description: HCN3 Antibody detects endogenous levels of total HCN3.
HCN3 Antibody
1-CSB-PA010218GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HCN3. Recognizes HCN3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
Polyclonal HCN3 Antibody (internal region)
APR12330G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HCN3 (internal region). This antibody is tested and proven to work in the following applications:
Polyclonal HCN3 antibody - middle region
APR12331G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HCN3 - middle region. This antibody is tested and proven to work in the following applications:
HCN3 Conjugated Antibody
C43682 100ul
EUR 397
anti- HCN3 antibody
FNab03789 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: hyperpolarization activated cyclic nucleotide-gated potassium channel 3
  • Uniprot ID: Q9P1Z3
  • Gene ID: 57657
  • Research Area: Cardiovascular
Description: Antibody raised against HCN3
Anti-HCN3 antibody
PAab03789 100 ug
EUR 386
Anti-HCN3 antibody
STJ72294 100 µg
EUR 359
Anti-HCN3 antibody
STJ191194 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HCN3
Hcn3/ Rat Hcn3 ELISA Kit
ELI-31647r 96 Tests
EUR 886
HCN3 siRNA
20-abx902428
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
HCN3 siRNA
20-abx919159
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
HCN3 siRNA
20-abx919160
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Monoclonal antibody for HCN3
SMC-306D 0.1mg
EUR 353
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is not conjugated.
Monoclonal antibody for HCN3
SMC-306D-A390 0.1mg
EUR 400
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 390.
Monoclonal antibody for HCN3
SMC-306D-A488 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 488.
Monoclonal antibody for HCN3
SMC-306D-A565 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 565.
Monoclonal antibody for HCN3
SMC-306D-A594 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 594.
Monoclonal antibody for HCN3
SMC-306D-A633 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 633.
Monoclonal antibody for HCN3
SMC-306D-A655 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 655.
Monoclonal antibody for HCN3
SMC-306D-A680 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 680.
Monoclonal antibody for HCN3
SMC-306D-A700 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 700.
Monoclonal antibody for HCN3
SMC-306D-ALP 0.1mg
EUR 393
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Alkaline Phosphatase.
Monoclonal antibody for HCN3
SMC-306D-APC 0.1mg
EUR 398
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with APC.
Monoclonal antibody for HCN3
SMC-306D-APCCY7 0.1mg
EUR 470
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with APC/Cy7.
Monoclonal antibody for HCN3
SMC-306D-BI 0.1mg
EUR 395
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Biotin.
Monoclonal antibody for HCN3
SMC-306D-DY350 0.1mg
EUR 413
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 350.
Monoclonal antibody for HCN3
SMC-306D-DY405 0.1mg
EUR 402
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 405.
Monoclonal antibody for HCN3
SMC-306D-DY488 0.1mg
EUR 392
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 488.
Monoclonal antibody for HCN3
SMC-306D-DY594 0.1mg
EUR 394
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 594.
Monoclonal antibody for HCN3
SMC-306D-DY633 0.1mg
EUR 389
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 633.
Monoclonal antibody for HCN3
SMC-306D-FITC 0.1mg
EUR 391
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with FITC.
Monoclonal antibody for HCN3
SMC-306D-HRP 0.1mg
EUR 387
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with HRP.
Monoclonal antibody for HCN3
SMC-306D-P594 0.1mg
EUR 406
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with PE/ATTO 594.
Monoclonal antibody for HCN3
SMC-306D-PCP 0.1mg
EUR 398
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with PerCP.
Monoclonal antibody for HCN3
SMC-306D-RPE 0.1mg
EUR 396
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with RPE.
Monoclonal antibody for HCN3
SMC-306D-STR 0.1mg
EUR 397
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Streptavidin.
Monoclonal antibody for HCN3
SMC-306S 0.012mg
EUR 65
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is not conjugated.
Polyclonal HCN3 (aa 715-728) Antibody (internal region)
APR12351G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HCN3 (aa 715-728) (internal region). This antibody is tested and proven to work in the following applications:
HCN3 Blocking Peptide
33R-5296 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HCN3 antibody, catalog no. 70R-5168
HCN3 cloning plasmid
CSB-CL868385HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1341
  • Sequence: atgctcagcatgatcgtaggtgccacatgctacgccatgttcatcggccatgccacggcactcatccagtccctggactcttcccggcgtcagtaccaggagaagtacaagcaggtggagcagtacatgtccttccacaagctgccagcagacacgcggcagcgcatccacgagt
  • Show more
Description: A cloning plasmid for the HCN3 gene.
HCN3 Blocking Peptide
DF9770-BP 1mg
EUR 195
Anti-HCN3 (aa 715-728) antibody
STJ72293 100 µg
EUR 359
Rat HCN3 shRNA Plasmid
20-abx987186
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
HCN3 ELISA KIT|Human
EF010077 96 Tests
EUR 689
Human HCN3 ELISA KIT
ELI-31591h 96 Tests
EUR 824
Mouse Hcn3 ELISA KIT
ELI-38902m 96 Tests
EUR 865
Mouse HCN3 shRNA Plasmid
20-abx970766
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human HCN3 shRNA Plasmid
20-abx961610
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
HCN3 Recombinant Protein (Human)
RP014485 100 ug Ask for price
pCMV-SPORT6-HCN3 Plasmid
PVT16573 2 ug
EUR 325
HCN3 Recombinant Protein (Rat)
RP204308 100 ug Ask for price
HCN3 Recombinant Protein (Mouse)
RP141071 100 ug Ask for price
HCN3 ORF Vector (Human) (pORF)
ORF004829 1.0 ug DNA
EUR 95
Hcn3 ORF Vector (Rat) (pORF)
ORF068104 1.0 ug DNA
EUR 506
Hcn3 ORF Vector (Mouse) (pORF)
ORF047025 1.0 ug DNA
EUR 506
HCN3 sgRNA CRISPR Lentivector set (Human)
K0938301 3 x 1.0 ug
EUR 339
Hcn3 sgRNA CRISPR Lentivector set (Mouse)
K5030201 3 x 1.0 ug
EUR 339
Hcn3 sgRNA CRISPR Lentivector set (Rat)
K7115901 3 x 1.0 ug
EUR 339
Rabbit Anti-Mouse Hyperpolarization-activated Cyclic Nucleotide-gated channel 3 (HCN3) antiserum
HCN31-S 100 ul
EUR 457
HCN3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0938302 1.0 ug DNA
EUR 154
HCN3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0938303 1.0 ug DNA
EUR 154
HCN3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0938304 1.0 ug DNA
EUR 154
Hcn3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K5030202 1.0 ug DNA
EUR 154
Hcn3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K5030203 1.0 ug DNA
EUR 154
Hcn3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K5030204 1.0 ug DNA
EUR 154
Hcn3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7115902 1.0 ug DNA
EUR 154
Hcn3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7115903 1.0 ug DNA
EUR 154
Hcn3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7115904 1.0 ug DNA
EUR 154
HCN3 Protein Vector (Rat) (pPB-C-His)
PV272414 500 ng
EUR 1166
HCN3 Protein Vector (Rat) (pPB-N-His)
PV272415 500 ng
EUR 1166
HCN3 Protein Vector (Rat) (pPM-C-HA)
PV272416 500 ng
EUR 1166
HCN3 Protein Vector (Rat) (pPM-C-His)
PV272417 500 ng
EUR 1166
HCN3 Protein Vector (Human) (pPB-C-His)
PV019313 500 ng
EUR 329
HCN3 Protein Vector (Human) (pPB-N-His)
PV019314 500 ng
EUR 329
HCN3 Protein Vector (Human) (pPM-C-HA)
PV019315 500 ng
EUR 329
HCN3 Protein Vector (Human) (pPM-C-His)
PV019316 500 ng
EUR 329
HCN3 Protein Vector (Mouse) (pPB-C-His)
PV188098 500 ng
EUR 1065
HCN3 Protein Vector (Mouse) (pPB-N-His)
PV188099 500 ng
EUR 1065
HCN3 Protein Vector (Mouse) (pPM-C-HA)
PV188100 500 ng
EUR 1065
HCN3 Protein Vector (Mouse) (pPM-C-His)
PV188101 500 ng
EUR 1065
Hcn3 3'UTR Luciferase Stable Cell Line
TU205674 1.0 ml Ask for price
Hcn3 3'UTR GFP Stable Cell Line
TU159397 1.0 ml Ask for price
HCN3 3'UTR Luciferase Stable Cell Line
TU009641 1.0 ml
EUR 1394
Hcn3 3'UTR Luciferase Stable Cell Line
TU109397 1.0 ml Ask for price
HCN3 3'UTR GFP Stable Cell Line
TU059641 1.0 ml
EUR 1394
Hcn3 3'UTR GFP Stable Cell Line
TU255674 1.0 ml Ask for price
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HCN3 Rabbit Polyclonal Antibody