KCNE1 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

KCNE1 Polyclonal Antibody
ABP59014-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human KCNE1 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of KCNE1 from Human, Mouse, Rat. This KCNE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNE1 protein at amino acid sequence of 40-120
KCNE1 Polyclonal Antibody
ABP59014-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human KCNE1 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of KCNE1 from Human, Mouse, Rat. This KCNE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNE1 protein at amino acid sequence of 40-120
KCNE1 Polyclonal Antibody
ES10025-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against KCNE1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
KCNE1 Polyclonal Antibody
ES10025-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against KCNE1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
KCNE1 Rabbit pAb
A14009-100ul 100 ul
EUR 308
KCNE1 Rabbit pAb
A14009-200ul 200 ul
EUR 459
KCNE1 Rabbit pAb
A14009-20ul 20 ul
EUR 183
KCNE1 Rabbit pAb
A14009-50ul 50 ul
EUR 223
KCNE1 Rabbit pAb
A1176-100ul 100 ul
EUR 308
KCNE1 Rabbit pAb
A1176-200ul 200 ul
EUR 459
KCNE1 Rabbit pAb
A1176-20ul 20 ul
EUR 183
KCNE1 Rabbit pAb
A1176-50ul 50 ul
EUR 223
KCNE1 antibody
70R-18067 50 ul
EUR 435
Description: Rabbit polyclonal KCNE1 antibody
KCNE1 Antibody
32205-100ul 100ul
EUR 252
KCNE1 Antibody
DF6310 200ul
EUR 304
Description: KCNE1 Antibody detects endogenous levels of total KCNE1.
KCNE1 Antibody
1-CSB-PA012025GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF
KCNE1 Antibody
1-CSB-PA012025LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
KCNE1 Antibody
ABD6310 100 ug
EUR 438
KCNE1 Conjugated Antibody
C32205 100ul
EUR 397
anti- KCNE1 antibody
FNab04482 100µg
EUR 505.25
  • Immunogen: potassium voltage-gated channel, Isk-related family, member 1
  • Uniprot ID: P15382
  • Gene ID: 3753
  • Research Area: Neuroscience, Cardiovascular
Description: Antibody raised against KCNE1
Anti-KCNE1 antibody
PAab04482 100 ug
EUR 355
Anti-KCNE1 antibody
STJ24291 100 µl
EUR 277
Description: The product of this gene belongs to the potassium channel KCNE family. Potassium ion channels are essential to many cellular functions and show a high degree of diversity, varying in their electrophysiologic and pharmacologic properties. This gene encodes a transmembrane protein known to associate with the product of the KVLQT1 gene to form the delayed rectifier potassium channel. Mutation in this gene are associated with both Jervell and Lange-Nielsen and Romano-Ward forms of long-QT syndrome. Alternatively spliced transcript variants encoding the same protein have been identified.
Anti-KCNE1 antibody
STJ115944 100 µl
EUR 277
Description: The product of this gene belongs to the potassium channel KCNE family. Potassium ion channels are essential to many cellular functions and show a high degree of diversity, varying in their electrophysiologic and pharmacologic properties. This gene encodes a transmembrane protein known to associate with the product of the KVLQT1 gene to form the delayed rectifier potassium channel. Mutation in this gene are associated with both Jervell and Lange-Nielsen and Romano-Ward forms of long-QT syndrome. Alternatively spliced transcript variants encoding the same protein have been identified.
Anti-KCNE1 antibody
STJ191183 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to KCNE1
Kcne1/ Rat Kcne1 ELISA Kit
ELI-47884r 96 Tests
EUR 886
KCNE1 siRNA
20-abx902780
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KCNE1 siRNA
20-abx921189
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KCNE1 siRNA
20-abx921190
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-KCNE1
YF-PA12825 50 ug
EUR 363
Description: Mouse polyclonal to KCNE1
anti-KCNE1
YF-PA12826 100 ul
EUR 403
Description: Rabbit polyclonal to KCNE1
anti-KCNE1
YF-PA12827 100 ug
EUR 403
Description: Rabbit polyclonal to KCNE1
anti-KCNE1
YF-PA24037 50 ul
EUR 334
Description: Mouse polyclonal to KCNE1
KCNE1 Antibody, HRP conjugated
1-CSB-PA012025LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
KCNE1 Antibody, FITC conjugated
1-CSB-PA012025LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
KCNE1 Antibody, Biotin conjugated
1-CSB-PA012025LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
KCNE1 Blocking Peptide
DF6310-BP 1mg
EUR 195
KCNE1 cloning plasmid
CSB-CL012025HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 318
  • Sequence: atgatcctgtctaacaccacagcggtgacgccctttctgaccaagctgtggcaggagacagttcagcagggtggcaacatgtcgggcctggcccacaggtccccccgcagcggtgacggcaagctggaggccctctacgtcctcatggtactgggattcttcggcttcttcaccct
  • Show more
Description: A cloning plasmid for the KCNE1 gene.
Anti-KCNE1 (5B12)
YF-MA10497 100 ug
EUR 363
Description: Mouse monoclonal to KCNE1
Anti-KCNE1 (2A6)
YF-MA13905 100 ug
EUR 363
Description: Mouse monoclonal to KCNE1
Mouse Kcne1 ELISA KIT
ELI-15824m 96 Tests
EUR 865
Human KCNE1 ELISA KIT
ELI-28086h 96 Tests
EUR 824
KCNE1 ELISA KIT|Human
EF010448 96 Tests
EUR 689
Rat KCNE1 shRNA Plasmid
20-abx985052
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human KCNE1 shRNA Plasmid
20-abx952529
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse KCNE1 shRNA Plasmid
20-abx971144
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
KCNE1 Recombinant Protein (Human)
RP016579 100 ug Ask for price
KCNE1 Recombinant Protein (Rat)
RP206747 100 ug Ask for price
KCNE1 Recombinant Protein (Mouse)
RP144986 100 ug Ask for price
Monoclonal KCNE1 Antibody (monoclonal) (M01), Clone: 5B12
AMM06086G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human KCNE1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 5B12. This antibody is applicable in WB, E
Monoclonal KCNE1 Antibody (monoclonal) (M13), Clone: 2A6
AMM06087G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human KCNE1 (monoclonal) (M13). The antibodies are raised in mouse and are from clone 2A6. This antibody is applicable in IP, E
Kcne1 ORF Vector (Rat) (pORF)
ORF068917 1.0 ug DNA
EUR 506
KCNE1 ORF Vector (Human) (pORF)
ORF005527 1.0 ug DNA
EUR 95
Kcne1 ORF Vector (Mouse) (pORF)
ORF048330 1.0 ug DNA
EUR 506
Kcne1 sgRNA CRISPR Lentivector set (Rat)
K6831501 3 x 1.0 ug
EUR 339
Kcne1 sgRNA CRISPR Lentivector set (Mouse)
K3368901 3 x 1.0 ug
EUR 339
KCNE1 sgRNA CRISPR Lentivector set (Human)
K1118301 3 x 1.0 ug
EUR 339
Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) ELISA kit
E04P0810-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) ELISA kit
E04P0810-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) ELISA kit
E04P0810-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Kcne1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6831502 1.0 ug DNA
EUR 154
Kcne1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6831503 1.0 ug DNA
EUR 154
Kcne1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6831504 1.0 ug DNA
EUR 154
Kcne1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3368902 1.0 ug DNA
EUR 154
Kcne1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3368903 1.0 ug DNA
EUR 154
Kcne1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3368904 1.0 ug DNA
EUR 154
KCNE1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1118302 1.0 ug DNA
EUR 154
KCNE1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1118303 1.0 ug DNA
EUR 154
KCNE1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1118304 1.0 ug DNA
EUR 154
KCNE1 Protein Vector (Human) (pPB-C-His)
PV022105 500 ng
EUR 329
KCNE1 Protein Vector (Human) (pPB-N-His)
PV022106 500 ng
EUR 329
KCNE1 Protein Vector (Human) (pPM-C-HA)
PV022107 500 ng
EUR 329
KCNE1 Protein Vector (Human) (pPM-C-His)
PV022108 500 ng
EUR 329
KCNE1 Protein Vector (Rat) (pPB-C-His)
PV275666 500 ng
EUR 603
KCNE1 Protein Vector (Rat) (pPB-N-His)
PV275667 500 ng
EUR 603
KCNE1 Protein Vector (Rat) (pPM-C-HA)
PV275668 500 ng
EUR 603
KCNE1 Protein Vector (Rat) (pPM-C-His)
PV275669 500 ng
EUR 603
KCNE1 Protein Vector (Mouse) (pPB-C-His)
PV193318 500 ng
EUR 603
KCNE1 Protein Vector (Mouse) (pPB-N-His)
PV193319 500 ng
EUR 603
KCNE1 Protein Vector (Mouse) (pPM-C-HA)
PV193320 500 ng
EUR 603
KCNE1 Protein Vector (Mouse) (pPM-C-His)
PV193321 500 ng
EUR 603
Kcne1 3'UTR Luciferase Stable Cell Line
TU110409 1.0 ml Ask for price
Kcne1 3'UTR GFP Stable Cell Line
TU160409 1.0 ml Ask for price
Kcne1 3'UTR Luciferase Stable Cell Line
TU206554 1.0 ml Ask for price
Kcne1 3'UTR GFP Stable Cell Line
TU256554 1.0 ml Ask for price
KCNE1 3'UTR GFP Stable Cell Line
TU061476 1.0 ml
EUR 4617
KCNE1 3'UTR Luciferase Stable Cell Line
TU011476 1.0 ml
EUR 4617
Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody
20-abx114637
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody
abx234482-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody
20-abx302181
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody
20-abx225257
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody
20-abx001090
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
KCNE1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV673873 1.0 ug DNA
EUR 514
KCNE1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV673877 1.0 ug DNA
EUR 514
KCNE1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV673878 1.0 ug DNA
EUR 514
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

KCNE1 Rabbit Polyclonal Antibody