KCNG4 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

KCNG4 Polyclonal Antibody

ABP59018-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human KCNG4 protein at amino acid sequence of 420-500
  • Applications tips:
Description: A polyclonal antibody for detection of KCNG4 from Human, Mouse. This KCNG4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNG4 protein at amino acid sequence of 420-500

KCNG4 Polyclonal Antibody

ABP59018-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human KCNG4 protein at amino acid sequence of 420-500
  • Applications tips:
Description: A polyclonal antibody for detection of KCNG4 from Human, Mouse. This KCNG4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNG4 protein at amino acid sequence of 420-500

KCNG4 Polyclonal Antibody

ABP59018-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human KCNG4 protein at amino acid sequence of 420-500
  • Applications tips:
Description: A polyclonal antibody for detection of KCNG4 from Human, Mouse. This KCNG4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNG4 protein at amino acid sequence of 420-500

KCNG4 Rabbit pAb

A14435-100ul 100 ul
EUR 308

KCNG4 Rabbit pAb

A14435-200ul 200 ul
EUR 459

KCNG4 Rabbit pAb

A14435-20ul 20 ul
EUR 183

KCNG4 Rabbit pAb

A14435-50ul 50 ul
EUR 223

KCNG4 Antibody

ABD9765 100 ug
EUR 438

KCNG4 antibody

70R-5178 50 ug
EUR 467
Description: Rabbit polyclonal KCNG4 antibody raised against the N terminal of KCNG4

KCNG4 Antibody

37677-100ul 100ul
EUR 252

KCNG4 Antibody

DF9765 200ul
EUR 304
Description: KCNG4 Antibody detects endogenous levels of total KCNG4.

KCNG4 Antibody

1-CSB-PA824775
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KCNG4. Recognizes KCNG4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:100-1:300

KCNG4 Antibody

1-CSB-PA844728LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNG4. Recognizes KCNG4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

KCNG4 Antibody

1-CSB-PA155172
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KCNG4. Recognizes KCNG4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:100-1:300

Polyclonal Kcng4 Antibody - middle region

AMM06109G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Kcng4 - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal KCNG4 antibody - N-terminal region

AMM06110G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNG4 - N-terminal region. This antibody is tested and proven to work in the following applications:

KCNG4 Conjugated Antibody

C37677 100ul
EUR 397

Anti-KCNG4 antibody

PAab04485 100 ug
EUR 412

Anti-KCNG4 antibody

STJ116645 100 µl
EUR 277
Description: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This member functions as a modulatory subunit. The gene has strong expression in brain. Multiple alternatively spliced variants have been found in normal and cancerous tissues.

Anti-KCNG4 antibody

STJ191188 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to KCNG4

KCNG4 siRNA

20-abx921204
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KCNG4 siRNA

20-abx921205
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-KCNG4

PVT12721 2 ug
EUR 391

KCNG4 Antibody, HRP conjugated

1-CSB-PA844728LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNG4. Recognizes KCNG4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KCNG4 Antibody, FITC conjugated

1-CSB-PA844728LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNG4. Recognizes KCNG4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

KCNG4 Antibody, Biotin conjugated

1-CSB-PA844728LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNG4. Recognizes KCNG4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

KCNG4 Blocking Peptide

33R-7518 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNG4 antibody, catalog no. 70R-5178

KCNG4 Blocking Peptide

DF9765-BP 1mg
EUR 195

KCNG4 cloning plasmid

CSB-CL844728HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 771
  • Sequence: atgcccatgccttccagagacgggggcctgcatcccagacaccaccactatggttcccacagcccttggagtcagctcctgtccagccccatggagacgccgtccatcaagggcctttactaccggagggtgcggaaggtgggtgccctggacgcctccccagtggacctgaagaa
  • Show more
Description: A cloning plasmid for the KCNG4 gene.

KCNG4 cloning plasmid

CSB-CL844728HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1560
  • Sequence: ATGCCCATGCCTTCCAGAGACGGGGGCCTGCATCCCAGACACCACCACTATGGTTCCCACAGCCCTTGGAGTCAGCTCCTGTCCAGCCCCATGGAGACGCCGTCCATCAAGGGCCTTTACTACCGGAGGGTGCGGAAGGTGGGTGCCCTGGACGCCTCCCCAGTGGACCTGAAGA
  • Show more
Description: A cloning plasmid for the KCNG4 gene.

Mouse KCNG4 shRNA Plasmid

20-abx975767
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human KCNG4 shRNA Plasmid

20-abx964188
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human KCNG4 ELISA KIT

ELI-23724h 96 Tests
EUR 824

KCNG4 ELISA KIT|Human

EF010451 96 Tests
EUR 689

Mouse Kcng4 ELISA KIT

ELI-42424m 96 Tests
EUR 865

KCNG4 Recombinant Protein (Human)

RP016597 100 ug Ask for price

KCNG4 Recombinant Protein (Human)

RP040240 100 ug Ask for price

KCNG4 Recombinant Protein (Rat)

RP206777 100 ug Ask for price

KCNG4 Recombinant Protein (Mouse)

RP145025 100 ug Ask for price

KCNG4 ORF Vector (Human) (pORF)

ORF005533 1.0 ug DNA
EUR 95

Kcng4 ORF Vector (Rat) (pORF)

ORF068927 1.0 ug DNA
EUR 506

Kcng4 ORF Vector (Mouse) (pORF)

ORF048343 1.0 ug DNA
EUR 506

KCNG4 ORF Vector (Human) (pORF)

ORF013414 1.0 ug DNA
EUR 354

KCNG4 sgRNA CRISPR Lentivector set (Human)

K1119201 3 x 1.0 ug
EUR 339

Kcng4 sgRNA CRISPR Lentivector set (Mouse)

K3275901 3 x 1.0 ug
EUR 339

Kcng4 sgRNA CRISPR Lentivector set (Rat)

K6476401 3 x 1.0 ug
EUR 339

KCNG4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1119202 1.0 ug DNA
EUR 154

KCNG4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1119203 1.0 ug DNA
EUR 154

KCNG4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1119204 1.0 ug DNA
EUR 154

Kcng4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3275902 1.0 ug DNA
EUR 154

Kcng4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3275903 1.0 ug DNA
EUR 154

Kcng4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3275904 1.0 ug DNA
EUR 154

Kcng4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6476402 1.0 ug DNA
EUR 154

Kcng4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6476403 1.0 ug DNA
EUR 154

Kcng4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6476404 1.0 ug DNA
EUR 154

KCNG4 Protein Vector (Human) (pPB-C-His)

PV053653 500 ng
EUR 481

KCNG4 Protein Vector (Human) (pPB-N-His)

PV053654 500 ng
EUR 481

KCNG4 Protein Vector (Human) (pPM-C-HA)

PV053655 500 ng
EUR 481

KCNG4 Protein Vector (Human) (pPM-C-His)

PV053656 500 ng
EUR 481

KCNG4 Protein Vector (Human) (pPB-C-His)

PV022129 500 ng
EUR 329

KCNG4 Protein Vector (Human) (pPB-N-His)

PV022130 500 ng
EUR 329

KCNG4 Protein Vector (Human) (pPM-C-HA)

PV022131 500 ng
EUR 329

KCNG4 Protein Vector (Human) (pPM-C-His)

PV022132 500 ng
EUR 329

KCNG4 Protein Vector (Rat) (pPB-C-His)

PV275706 500 ng
EUR 603

KCNG4 Protein Vector (Rat) (pPB-N-His)

PV275707 500 ng
EUR 603

KCNG4 Protein Vector (Rat) (pPM-C-HA)

PV275708 500 ng
EUR 603

KCNG4 Protein Vector (Rat) (pPM-C-His)

PV275709 500 ng
EUR 603

KCNG4 Protein Vector (Mouse) (pPB-C-His)

PV193370 500 ng
EUR 603

KCNG4 Protein Vector (Mouse) (pPB-N-His)

PV193371 500 ng
EUR 603

KCNG4 Protein Vector (Mouse) (pPM-C-HA)

PV193372 500 ng
EUR 603

KCNG4 Protein Vector (Mouse) (pPM-C-His)

PV193373 500 ng
EUR 603

Kcng4 3'UTR Luciferase Stable Cell Line

TU206563 1.0 ml Ask for price

Kcng4 3'UTR GFP Stable Cell Line

TU160418 1.0 ml Ask for price

KCNG4 3'UTR Luciferase Stable Cell Line

TU011485 1.0 ml
EUR 1394

Kcng4 3'UTR Luciferase Stable Cell Line

TU110418 1.0 ml Ask for price

KCNG4 3'UTR GFP Stable Cell Line

TU061485 1.0 ml
EUR 1394

Kcng4 3'UTR GFP Stable Cell Line

TU256563 1.0 ml Ask for price

Potassium Voltage-Gated Channel Subfamily G Member 4 (KCNG4) Antibody

abx216380-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Potassium Voltage-Gated Channel Subfamily G Member 4 (KCNG4) Antibody

abx234485-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Potassium Voltage-Gated Channel Subfamily G Member 4 (KCNG4) Antibody

20-abx302234
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Potassium Voltage-Gated Channel Subfamily G Member 4 (KCNG4) Antibody

20-abx213133
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Potassium Voltage-Gated Channel Subfamily G Member 4 (KCNG4) Antibody

20-abx213134
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

KCNG4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV703917 1.0 ug DNA
EUR 450

KCNG4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV703921 1.0 ug DNA
EUR 450

KCNG4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV703922 1.0 ug DNA
EUR 450

Potassium Voltage-Gated Channel Subfamily G Member 4 (KCNG4) Antibody (HRP)

20-abx315478
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Potassium Voltage-Gated Channel Subfamily G Member 4 (KCNG4) Antibody (FITC)

20-abx315479
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Potassium Voltage-Gated Channel Subfamily G Member 4 (KCNG4) Antibody (Biotin)

20-abx315480
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

KCNG4 Rabbit Polyclonal Antibody