KCNQ1 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

KCNQ1 Polyclonal Antibody
ABP59023-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human KCNQ1 protein at amino acid sequence of 350-430
  • Applications tips:
Description: A polyclonal antibody for detection of KCNQ1 from Human. This KCNQ1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNQ1 protein at amino acid sequence of 350-430
KCNQ1 Polyclonal Antibody
ABP59023-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human KCNQ1 protein at amino acid sequence of 350-430
  • Applications tips:
Description: A polyclonal antibody for detection of KCNQ1 from Human. This KCNQ1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNQ1 protein at amino acid sequence of 350-430
KCNQ1 Polyclonal Antibody
ES10032-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against KCNQ1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
KCNQ1 Polyclonal Antibody
ES10032-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against KCNQ1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
KCNQ1 Rabbit pAb
A2174-100ul 100 ul
EUR 308
KCNQ1 Rabbit pAb
A2174-200ul 200 ul
EUR 459
KCNQ1 Rabbit pAb
A2174-20ul 20 ul
EUR 183
KCNQ1 Rabbit pAb
A2174-50ul 50 ul
EUR 223
Polyclonal KV7.1 (KCNQ1) Antibody
AMM06230G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KV7.1 (KCNQ1) . This antibody is tested and proven to work in the following applications:
KCNQ1 antibody
70R-1537 100 ug
EUR 377
Description: Rabbit polyclonal KCNQ1 antibody raised against the N terminal of KCNQ1
KCNQ1 Antibody
32641-100ul 100ul
EUR 252
KCNQ1 Antibody
1-CSB-PA942745
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KCNQ1. Recognizes KCNQ1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200
KCNQ1 Antibody
DF6897 200ul
EUR 304
Description: KCNQ1 Antibody detects endogenous levels of total KCNQ1.
KCNQ1 Antibody
DF7568 200ul
EUR 304
Description: KCNQ1 Antibody detects endogenous levels of total KCNQ1.
KCNQ1 Antibody
1-CSB-PA237012
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KCNQ1. Recognizes KCNQ1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000
KCNQ1 antibody
70R-5042 50 ug
EUR 467
Description: Rabbit polyclonal KCNQ1 antibody raised against the N terminal of KCNQ1
KCNQ1 Antibody
CSB-PA012087KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against KCNQ1. Recognizes KCNQ1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
KCNQ1 Antibody
CSB-PA012087KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against KCNQ1. Recognizes KCNQ1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
KCNQ1 Antibody
ABD6897 100 ug
EUR 438
KCNQ1 Antibody
ABD7568 100 ug
EUR 438
Polyclonal Goat Anti-KCNQ1 Antibody
APR12124G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-KCNQ1 . This antibody is tested and proven to work in the following applications:
Anti-KCNQ1 Antibody
A00310-1 100ug/vial
EUR 294
KCNQ1 Conjugated Antibody
C32641 100ul
EUR 397
Anti-KCNQ1 antibody
STJ24299 100 µl
EUR 277
Description: This gene encodes a voltage-gated potassium channel required for repolarization phase of the cardiac action potential. This protein can form heteromultimers with two other potassium channel proteins, KCNE1 and KCNE3. Mutations in this gene are associated with hereditary long QT syndrome 1 (also known as Romano-Ward syndrome), Jervell and Lange-Nielsen syndrome, and familial atrial fibrillation. This gene exhibits tissue-specific imprinting, with preferential expression from the maternal allele in some tissues, and biallelic expression in others. This gene is located in a region of chromosome 11 amongst other imprinted genes that are associated with Beckwith-Wiedemann syndrome (BWS), and itself has been shown to be disrupted by chromosomal rearrangements in patients with BWS. Alternatively spliced transcript variants have been found for this gene.
Anti-KCNQ1 antibody
STJ71861 100 µg
EUR 359
Anti-KCNQ1 antibody
STJ191190 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to KCNQ1
Kcnq1/ Rat Kcnq1 ELISA Kit
ELI-47888r 96 Tests
EUR 886
KCNQ1 siRNA
20-abx902818
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KCNQ1 siRNA
20-abx921304
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KCNQ1 siRNA
20-abx921305
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Monoclonal antibody for KCNQ1
SMC-307D 0.1mg
EUR 353
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is not conjugated.
Monoclonal antibody for KCNQ1
SMC-307D-A390 0.1mg
EUR 400
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with ATTO 390.
Monoclonal antibody for KCNQ1
SMC-307D-A488 0.1mg
EUR 399
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with ATTO 488.
Monoclonal antibody for KCNQ1
SMC-307D-A565 0.1mg
EUR 399
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with ATTO 565.
Monoclonal antibody for KCNQ1
SMC-307D-A594 0.1mg
EUR 399
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with ATTO 594.
Monoclonal antibody for KCNQ1
SMC-307D-A633 0.1mg
EUR 399
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with ATTO 633.
Monoclonal antibody for KCNQ1
SMC-307D-A655 0.1mg
EUR 399
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with ATTO 655.
Monoclonal antibody for KCNQ1
SMC-307D-A680 0.1mg
EUR 399
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with ATTO 680.
Monoclonal antibody for KCNQ1
SMC-307D-A700 0.1mg
EUR 399
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with ATTO 700.
Monoclonal antibody for KCNQ1
SMC-307D-ALP 0.1mg
EUR 393
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with Alkaline Phosphatase.
Monoclonal antibody for KCNQ1
SMC-307D-APC 0.1mg
EUR 398
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with APC.
Monoclonal antibody for KCNQ1
SMC-307D-APCCY7 0.1mg
EUR 470
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with APC/Cy7.
Monoclonal antibody for KCNQ1
SMC-307D-BI 0.1mg
EUR 395
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with Biotin.
Monoclonal antibody for KCNQ1
SMC-307D-DY350 0.1mg
EUR 413
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with Dylight 350.
Monoclonal antibody for KCNQ1
SMC-307D-DY405 0.1mg
EUR 402
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with Dylight 405.
Monoclonal antibody for KCNQ1
SMC-307D-DY488 0.1mg
EUR 392
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with Dylight 488.
Monoclonal antibody for KCNQ1
SMC-307D-DY594 0.1mg
EUR 394
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with Dylight 594.
Monoclonal antibody for KCNQ1
SMC-307D-DY633 0.1mg
EUR 389
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with Dylight 633.
Monoclonal antibody for KCNQ1
SMC-307D-FITC 0.1mg
EUR 391
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with FITC.
Monoclonal antibody for KCNQ1
SMC-307D-HRP 0.1mg
EUR 387
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with HRP.
Monoclonal antibody for KCNQ1
SMC-307D-P594 0.1mg
EUR 406
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with PE/ATTO 594.
Monoclonal antibody for KCNQ1
SMC-307D-PCP 0.1mg
EUR 398
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with PerCP.
Monoclonal antibody for KCNQ1
SMC-307D-RPE 0.1mg
EUR 396
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with RPE.
Monoclonal antibody for KCNQ1
SMC-307D-STR 0.1mg
EUR 397
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with Streptavidin.
Monoclonal antibody for KCNQ1
SMC-307S 0.012mg
EUR 65
  • Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
  • Show more
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is not conjugated.
KCNQ1 Blocking Peptide
33R-4211 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNQ1 antibody, catalog no. 70R-1537
KCNQ1 Blocking Peptide
33R-8193 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNQ1 antibody, catalog no. 70R-5042
KCNQ1 Blocking Peptide
DF6897-BP 1mg
EUR 195
KCNQ1 Blocking Peptide
DF7568-BP 1mg
EUR 195
KCNQ1 cloning plasmid
CSB-CL012087HU-10ug 10ug
EUR 572
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1650
  • Sequence: atggacttcctcatcgtcctggtctgcctcatcttcagcgtgctgtccaccatcgagcagtatgccgccctggccacggggactctcttctggatggagatcgtgctggtggtgttcttcgggacggagtacgtggtccgcctctggtccgccggctgccgcagcaagtacgtgg
  • Show more
Description: A cloning plasmid for the KCNQ1 gene.
anti-KCNQ1 (5E12)
LF-MA30660 100 ul
EUR 527
Description: Mouse Monoclonal to KCNQ1
pcDNA3.1-KCNQ1 Plasmid
PVTB00262-2a 2 ug
EUR 356
Monoclonal KCNQ1 Antibody, Clone: 5E12
APR16986G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human KCNQ1. The antibodies are raised in Mouse and are from clone 5E12. This antibody is applicable in WB, FC, E
KCNQ1 Downstream Neighbor Protein (KCNQ1DN) Antibody
abx234500-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Mouse Kcnq1 ELISA KIT
ELI-28090m 96 Tests
EUR 865
Human KCNQ1 ELISA KIT
ELI-08085h 96 Tests
EUR 824
Rat KCNQ1 shRNA Plasmid
20-abx986895
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human KCNQ1 shRNA Plasmid
20-abx952558
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse KCNQ1 shRNA Plasmid
20-abx971167
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Kv7.1/KCNQ1 K+ channel
MO50022 100 ul
EUR 579
KCNQ1 Recombinant Protein (Human)
RP040264 100 ug Ask for price
KCNQ1 Recombinant Protein (Rat)
RP206939 100 ug Ask for price
KCNQ1 Recombinant Protein (Mouse)
RP145316 100 ug Ask for price
Kcnq1 ORF Vector (Rat) (pORF)
ORF068981 1.0 ug DNA
EUR 506
KCNQ1 ORF Vector (Human) (pORF)
ORF013422 1.0 ug DNA
EUR 354
Kcnq1 ORF Vector (Mouse) (pORF)
ORF048440 1.0 ug DNA
EUR 506
Kcnq1 sgRNA CRISPR Lentivector set (Rat)
K7015801 3 x 1.0 ug
EUR 339
Kcnq1 sgRNA CRISPR Lentivector set (Mouse)
K3951901 3 x 1.0 ug
EUR 339
KCNQ1 sgRNA CRISPR Lentivector set (Human)
K1124501 3 x 1.0 ug
EUR 339
KCNQ1-AS1 ORF Vector (Human) (pORF)
ORF022146 1.0 ug DNA Ask for price
Rabbit Potassium voltage gated channel subfamily KQT member 1(KCNQ1) ELISA kit
E04P0812-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Potassium voltage gated channel subfamily KQT member 1(KCNQ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Potassium voltage gated channel subfamily KQT member 1(KCNQ1) ELISA kit
E04P0812-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Potassium voltage gated channel subfamily KQT member 1(KCNQ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Potassium voltage gated channel subfamily KQT member 1(KCNQ1) ELISA kit
E04P0812-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Potassium voltage gated channel subfamily KQT member 1(KCNQ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Kcnq1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7015802 1.0 ug DNA
EUR 154
Kcnq1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7015803 1.0 ug DNA
EUR 154
Kcnq1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7015804 1.0 ug DNA
EUR 154
Kcnq1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3951902 1.0 ug DNA
EUR 154
Kcnq1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3951903 1.0 ug DNA
EUR 154
Kcnq1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3951904 1.0 ug DNA
EUR 154
KCNQ1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1124502 1.0 ug DNA
EUR 154
KCNQ1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1124503 1.0 ug DNA
EUR 154
KCNQ1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1124504 1.0 ug DNA
EUR 154
KCNQ1 Protein Vector (Rat) (pPB-C-His)
PV275922 500 ng
EUR 1166
KCNQ1 Protein Vector (Rat) (pPB-N-His)
PV275923 500 ng
EUR 1166
KCNQ1 Protein Vector (Rat) (pPM-C-HA)
PV275924 500 ng
EUR 1166
KCNQ1 Protein Vector (Rat) (pPM-C-His)
PV275925 500 ng
EUR 1166
KCNQ1 Protein Vector (Mouse) (pPB-C-His)
PV193758 500 ng
EUR 1065
KCNQ1 Protein Vector (Mouse) (pPB-N-His)
PV193759 500 ng
EUR 1065
KCNQ1 Protein Vector (Mouse) (pPM-C-HA)
PV193760 500 ng
EUR 1065
KCNQ1 Protein Vector (Mouse) (pPM-C-His)
PV193761 500 ng
EUR 1065
KCNQ1 Protein Vector (Human) (pPB-C-His)
PV053685 500 ng
EUR 481
KCNQ1 Protein Vector (Human) (pPB-N-His)
PV053686 500 ng
EUR 481
KCNQ1 Protein Vector (Human) (pPM-C-HA)
PV053687 500 ng
EUR 481
KCNQ1 Protein Vector (Human) (pPM-C-His)
PV053688 500 ng
EUR 481
Kcnq1 3'UTR Luciferase Stable Cell Line
TU110468 1.0 ml Ask for price
Kcnq1 3'UTR GFP Stable Cell Line
TU160468 1.0 ml Ask for price
Kcnq1 3'UTR Luciferase Stable Cell Line
TU206613 1.0 ml Ask for price
Kcnq1 3'UTR GFP Stable Cell Line
TU256613 1.0 ml Ask for price
KCNQ1 3'UTR GFP Stable Cell Line
TU061538 1.0 ml
EUR 1394
KCNQ1 3'UTR Luciferase Stable Cell Line
TU011538 1.0 ml
EUR 1394
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody
abx026614-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody
abx026614-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody
abx015902-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody
20-abx214196
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody
20-abx214279
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody
abx117240-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody
abx145734-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody
abx034169-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody
abx034169-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody
abx431372-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody
abx444962-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody
20-abx001786
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

KCNQ1 Rabbit Polyclonal Antibody