Molecular evaluation of a stress-induced cDNA encoding the interpretation initiation issue

Dissecting effectivity of a 5′ quick amplification of cDNA ends (5′-RACE) technique for profiling T-cell receptor beta repertoire

  • Deep sequencing of T-cell receptor (TCR) genes is extremely efficient at profiling immune repertoire. To arrange a TCR sequencing library, multiplex polymerase chain response (mPCR) is broadly utilized and is extraordinarily setting pleasant.

 

  • That is, most mPCR merchandise embody the world very important for antigen recognition, which moreover signifies frequent V(D)J recombination. Multiplex PCR, nonetheless, might endure from primer bias. A promising totally different is 5′-RACE, which avoids primer bias by making use of only one primer pair. In 5′-RACE info, nonetheless, non-regular V(D)J recombination (e.g., TCR sequences and never utilizing a V gene part) has been seen and the frequency varies (30-80%) between analysis.

 

  • This means that the explanation for or learn the way to cut back non-regular TCR sequences is not however well-known by the science neighborhood. Although it is doable to take a place the set off by evaluating the 5′-RACE protocols, cautious experimental affirmation is required and such a scientific look at continues to be not obtainable.

 

  • Proper right here, we examined the 5′-RACE protocol of a industrial gear and demonstrated how a modification elevated the fraction of regular TCR-β sequences to >85%. We moreover found a strong linear correlation between the fraction of fast DNA fragments and the proportion of non-regular TCR-β sequences, indicating that the presence of fast DNA fragments throughout the library was the first motive behind non-regular TCR-β sequences.

 

  • Subsequently, thorough elimination of fast DNA fragments from a 5′-RACE library is the essential factor to extreme info effectivity. We extraordinarily advocate conducting a fraction measurement analysis sooner than sequencing, and the fraction of fast DNA fragments could be utilized to estimate the proportion of non-regular TCR sequences. As deep sequencing of TCR genes continues to be comparatively pricey, good prime quality administration have to be worthwhile.
ifarai
ifarai

NUDCD3 siRNA

20-abx926555
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223- NUDCD3

PVT11465 2 ug
EUR 273

anti-NUDCD3

YF-PA17860 50 ug
EUR 363
Description: Mouse polyclonal to NUDCD3

NUDCD3 Blocking Peptide

33R-4441 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUDCD3 antibody, catalog no. 70R-3285

NUDCD3 Conjugated Antibody

C42980 100ul
EUR 397

NUDCD3 cloning plasmid

CSB-CL811605HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 663
  • Sequence: atggcccatggttcacaggaggcagaagctccaggagcagttgctggtgctgctgaagtccctagggaaccaccaattcttcccaggattcaggagcagttccagaaaaatcccgacagttacaatggtgctgtccgagagaactacacctggtcacaggactatactgacctgga
  • Show more
Description: A cloning plasmid for the NUDCD3 gene.

NUDCD3 cloning plasmid

CSB-CL811605HU2-10ug 10ug
EUR 413
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1086
  • Sequence: atggagccaggggcggccgagctgtatgaccaggcccttttgggcatcctgcagcacgtgggcaacgtccaggatttcctgcgcgttctctttggcttcctctaccgcaagacagacttctatcgcttgctgcgccacccatcggaccgcatgggcttcccgcccggggccgcgc
  • Show more
Description: A cloning plasmid for the NUDCD3 gene.

NUDCD3 Polyclonal Antibody

A60090 100 µg
EUR 570.55
Description: reagents widely cited

NUDCD3 Rabbit pAb

A18436-100ul 100 ul
EUR 308

NUDCD3 Rabbit pAb

A18436-200ul 200 ul
EUR 459

NUDCD3 Rabbit pAb

A18436-20ul 20 ul
EUR 183

NUDCD3 Rabbit pAb

A18436-50ul 50 ul
EUR 223

anti- NUDCD3 antibody

FNab05897 100µg
EUR 585
  • Immunogen: NudC domain containing 3
  • Uniprot ID: Q8IVD9
  • Gene ID: 23386
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against NUDCD3

Anti-NUDCD3 antibody

PAab05897 100 ug
EUR 412

pCMV-SPORT6-NUDCD3

PVT12543 2 ug
EUR 391

Anti-NUDCD3 antibody

STJ11100390 100 µl
EUR 277

NUDCD3 Antibody, HRP conjugated

1-CSB-PA811605LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUDCD3. Recognizes NUDCD3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NUDCD3 Antibody, FITC conjugated

1-CSB-PA811605LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUDCD3. Recognizes NUDCD3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NUDCD3 Antibody, Biotin conjugated

1-CSB-PA811605LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUDCD3. Recognizes NUDCD3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NUDCD3 ELISA KIT|Human

EF001364 96 Tests
EUR 689

Human NUDCD3 shRNA Plasmid

20-abx958230
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NUDCD3 shRNA Plasmid

20-abx980627
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NUDCD3 Recombinant Protein (Human)

RP021817 100 ug Ask for price

NUDCD3 Recombinant Protein (Human)

RP021820 100 ug Ask for price

NUDCD3 Recombinant Protein (Mouse)

RP155360 100 ug Ask for price

NUDCD3 Recombinant Protein (Rat)

RP214763 100 ug Ask for price

NUDCD3 Polyclonal Antibody, Biotin Conjugated

A60091 100 µg
EUR 570.55
Description: Ask the seller for details

NUDCD3 Polyclonal Antibody, FITC Conjugated

A60092 100 µg
EUR 570.55
Description: The best epigenetics products

NUDCD3 Polyclonal Antibody, HRP Conjugated

A60093 100 µg
EUR 570.55
Description: kits suitable for this type of research

Nudcd3 ORF Vector (Rat) (pORF)

ORF071589 1.0 ug DNA
EUR 506

NUDCD3 ORF Vector (Human) (pORF)

ORF007273 1.0 ug DNA
EUR 95

NUDCD3 ORF Vector (Human) (pORF)

ORF007274 1.0 ug DNA
EUR 95

Nudcd3 ORF Vector (Mouse) (pORF)

ORF051788 1.0 ug DNA
EUR 506

cDNA Synthesis SuperMix

20-abx09801420ulSystems
  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Evo? cDNA Kit

M1164-100
EUR 294

Evo? cDNA Kit

M1164-25
EUR 234

Novo? cDNA Kit

M1165-100
EUR 354

Novo? cDNA Kit

M1165-25
EUR 267

Evo? cDNA Supermix

M1168-100
EUR 381

Evo? cDNA Supermix

M1168-25
EUR 267

Novo? cDNA Supermix

M1169-100
EUR 441

Novo? cDNA Supermix

M1169-25
EUR 289

NudC Domain Containing 3 (NUDCD3) Antibody

abx235897-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

NudC Domain Containing 3 (NUDCD3) Antibody

20-abx302663
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nudcd3 sgRNA CRISPR Lentivector set (Rat)

K7522401 3 x 1.0 ug
EUR 339

Nudcd3 sgRNA CRISPR Lentivector set (Mouse)

K4846501 3 x 1.0 ug
EUR 339

NUDCD3 sgRNA CRISPR Lentivector set (Human)

K1463701 3 x 1.0 ug
EUR 339

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)

20-abx09801620ulSystems
  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)

20-abx09802120ulSystems
  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean

C1634370 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA Probe Diluent Solution

AR0063 5mL
EUR 106

cDNA from Arteriosclerosis: Aorta

C1236012Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery

C1236013Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery

C1236013Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein

C1236020Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon

C1236090Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart

C1236122Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart

C1236122Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney

C1236142Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney

C1236142Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver

C1236149Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung

C1236152Ld-1 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung

C1236152Ld-2 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung

C1236152Ld-3 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung

C1236152Ld-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung

C1236152Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas

C1236188Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen

C1236246Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach

C1236248Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Tetro cDNA Synthesis Kit

BIO-65042 30 Reactions Ask for price

Tetro cDNA Synthesis Kit

BIO-65043 100 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053 50 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053/S Sample Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65054 250 Reactions Ask for price

OneScriptPlus cDNA Synthesis Kit

G235 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis Kit

G236 100 x 20 ul reactions
EUR 169

OneScriptPlus cDNA Synthesis SuperMix

G453 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis SuperMix

G454 100 x 20 ul reactions
EUR 169

circRNA cDNA Synthesis Kit

G627 25 rxn (20 ul/rxn)
EUR 309

Human eNOS cDNA probe

eNOS51-D-2 2 ug
EUR 445

Novo? Transcriptome cDNA Kit

M1167-100
EUR 952

Novo? Transcriptome cDNA Kit

M1167-25
EUR 441

Plant Tissue cDNA: Arabidopsis

PC34-310 10 rxn
EUR 415

NudC Domain Containing 3 (NUDCD3) Antibody (HRP)

20-abx308546
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NudC Domain Containing 3 (NUDCD3) Antibody (FITC)

20-abx308547
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NudC Domain Containing 3 (NUDCD3) Antibody (Biotin)

20-abx308548
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nudcd3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7522402 1.0 ug DNA
EUR 154

Nudcd3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7522403 1.0 ug DNA
EUR 154

Nudcd3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7522404 1.0 ug DNA
EUR 154

Nudcd3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4846502 1.0 ug DNA
EUR 154

Nudcd3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4846503 1.0 ug DNA
EUR 154

Nudcd3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4846504 1.0 ug DNA
EUR 154

NUDCD3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1463702 1.0 ug DNA
EUR 154

NUDCD3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1463703 1.0 ug DNA
EUR 154

NUDCD3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1463704 1.0 ug DNA
EUR 154

NUDCD3 Protein Vector (Rat) (pPB-C-His)

PV286354 500 ng
EUR 603

NUDCD3 Protein Vector (Rat) (pPB-N-His)

PV286355 500 ng
EUR 603

NUDCD3 Protein Vector (Rat) (pPM-C-HA)

PV286356 500 ng
EUR 603

NUDCD3 Protein Vector (Rat) (pPM-C-His)

PV286357 500 ng
EUR 603

NUDCD3 Protein Vector (Mouse) (pPB-C-His)

PV207150 500 ng
EUR 603

NUDCD3 Protein Vector (Mouse) (pPB-N-His)

PV207151 500 ng
EUR 603

NUDCD3 Protein Vector (Mouse) (pPM-C-HA)

PV207152 500 ng
EUR 603

NUDCD3 Protein Vector (Mouse) (pPM-C-His)

PV207153 500 ng
EUR 603

NUDCD3 Protein Vector (Human) (pPB-C-His)

PV029089 500 ng
EUR 329

NUDCD3 Protein Vector (Human) (pPB-N-His)

PV029090 500 ng
EUR 329

NUDCD3 Protein Vector (Human) (pPM-C-HA)

PV029091 500 ng
EUR 329

NUDCD3 Protein Vector (Human) (pPM-C-His)

PV029092 500 ng
EUR 329

NUDCD3 Protein Vector (Human) (pPB-C-His)

PV029093 500 ng
EUR 329

NUDCD3 Protein Vector (Human) (pPB-N-His)

PV029094 500 ng
EUR 329

NUDCD3 Protein Vector (Human) (pPM-C-HA)

PV029095 500 ng
EUR 329

NUDCD3 Protein Vector (Human) (pPM-C-His)

PV029096 500 ng
EUR 329

Nudcd3 3'UTR Luciferase Stable Cell Line

TU114400 1.0 ml Ask for price

Nudcd3 3'UTR GFP Stable Cell Line

TU164400 1.0 ml Ask for price

Nudcd3 3'UTR Luciferase Stable Cell Line

TU214265 1.0 ml Ask for price

Nudcd3 3'UTR GFP Stable Cell Line

TU264265 1.0 ml Ask for price

NUDCD3 3'UTR GFP Stable Cell Line

TU066058 1.0 ml
EUR 2333

NUDCD3 3'UTR Luciferase Stable Cell Line

TU016058 1.0 ml
EUR 2333

cDNA Synthesis SuperMix for qPCR

20-abx09801920ulSystems
  • EUR 690.00
  • EUR 565.00
  • 100 rxns ×20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

cDNA from Alzheimer's Disease: Brain

C1236035Alz 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Brain

C1236035Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Parkinson's Disease: Brain

C1236035Par 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dementia: Brain: Hippocampus

C1236052Dem 40 reactions
EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Depression: Brain: Hippocampus

C1236052Dep 40 reactions
EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Colon

C1236090Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

 

Evaluation discover: Huge gene family of phosphoenolpyruvate carboxylase throughout the crassulacean acid metabolism plant Kalanchoepinnata (Crassulaceae) characterised by partial cDNA sequence analysis

Clones coding for a 1100-bp cDNA sequence of phosphoenolpyruvate carboxylase (PEPC) of the constitutive crassulacean acid metabolism (CAM) plant Kalanchoepinnata (Lam.) Pers., have been isolated by reverse transcription-polymerase chain response (RT-PCR) and characterised by restriction fragment measurement polymorphism analysis and DNA sequencing.

 

Seven distinct PEPC isogenes have been recovered, four in leaves and three in roots (EMBL accession numbers: AJ344052-AJ344058). Sequence similarity comparisons and distance neighbour-joining calculations separate the seven PEPC isoforms into two clades, one in all which contains the three PEPCs current in roots. The second clade contains the four isoforms current in leaves and is break up into two branches, one in all which contains two PEPCs most associated with described beforehand CAM isoforms.

 

Of these two isoforms, nonetheless, only one exhibited appreciable expression in CAM-performing leaves, nonetheless not in very youthful leaves, which do not exhibit CAM, suggesting this isoform encodes a CAM-specific PEPC. Protein sequence calculations counsel that each one isogenes are seemingly derived from an ordinary ancestor gene, presumably by serial gene duplication events. To our information, that’s basically probably the most full identification of a PEPC gene family from a CAM plant, and one of the best number of PEPC isogenes reported for any vascular plant to this point.

 

 

Molecular analysis of a stress-induced cDNA encoding the interpretation initiation concern, eIF1, from the salt-tolerant wild relative of rice, Porteresiacoarctata

The analysis of plant response to emphasise is a vital path to the invention of genes conferring stress tolerance. Protein synthesis is very delicate to salt stress and proteins involved on this course of may be an very important determinant of salt tolerance.

 

The halophytic plant, PorteresiacoarctataTateoka, is an in depth relative of Oryzasativa L., and has the facility to withstand sudden changes throughout the soil salinity. The interpretation initiation concern 1 (PceIF1) cDNA was isolated from the leaves of P. coarctata that had been subjected to a high-salt remedy (150 mm NaCl). An expression look at confirmed that the abundance of eIF1 transcripts elevated to a most diploma 5 d after stress induction after which decreased to ranges very similar to leaves of administration (unsalinised) crops.

 

This gene was moreover up-regulated in exogenous abscisic acid (ABA) and mannitol therapies, suggesting that its induction is expounded to the water deficit influence of extreme salt. Our analysis confirmed that expression ranges of eIF1 transcripts might type a helpful indicator for monitoring a stress-responsive mechanism that operates throughout the leaves of P. coarctata.

 

WDR78 cloning plasmid

CSB-CL719620HU2-10ug 10ug
EUR 822
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2547
  • Sequence: atgacgcccggcaaacattccggagcctcggcccgagccgctaacgcaggagcttgggggtacagggacttcagaggcggccaaaaaaaggggtggtggaccactccccagctggtcgccaccatgccagtctctccggcaggcagtcacaagcagcagaacttcgggttgaaca
  • Show more
Description: A cloning plasmid for the WDR78 gene.

Rat WDR78 shRNA Plasmid

20-abx989767
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse WDR78 shRNA Plasmid

20-abx982585
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human WDR78 shRNA Plasmid

20-abx962588
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Wdr78 ORF Vector (Mouse) (pORF)

ORF061805 1.0 ug DNA
EUR 506

Wdr78 ORF Vector (Rat) (pORF)

ORF079111 1.0 ug DNA
EUR 506

WDR78 ORF Vector (Human) (pORF)

ORF014948 1.0 ug DNA
EUR 354

WDR78 ORF Vector (Human) (pORF)

ORF011578 1.0 ug DNA
EUR 95

Wdr78 sgRNA CRISPR Lentivector set (Rat)

K6359901 3 x 1.0 ug
EUR 339

WDR78 sgRNA CRISPR Lentivector set (Human)

K2635401 3 x 1.0 ug
EUR 339

Wdr78 sgRNA CRISPR Lentivector set (Mouse)

K4526301 3 x 1.0 ug
EUR 339

cDNA Synthesis SuperMix

20-abx09801420ulSystems
  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Evo? cDNA Kit

M1164-100
EUR 294

Evo? cDNA Kit

M1164-25
EUR 234

Novo? cDNA Kit

M1165-100
EUR 354

Novo? cDNA Kit

M1165-25
EUR 267

Evo? cDNA Supermix

M1168-100
EUR 381

Evo? cDNA Supermix

M1168-25
EUR 267

Novo? cDNA Supermix

M1169-100
EUR 441

Novo? cDNA Supermix

M1169-25
EUR 289

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

WD Repeat-Containing Protein 78 (WDR78) Antibody

abx037278-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Wdr78 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6359902 1.0 ug DNA
EUR 154

Wdr78 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6359903 1.0 ug DNA
EUR 154

Wdr78 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6359904 1.0 ug DNA
EUR 154

WDR78 sgRNA CRISPR Lentivector (Human) (Target 1)

K2635402 1.0 ug DNA
EUR 154

WDR78 sgRNA CRISPR Lentivector (Human) (Target 2)

K2635403 1.0 ug DNA
EUR 154

WDR78 sgRNA CRISPR Lentivector (Human) (Target 3)

K2635404 1.0 ug DNA
EUR 154

Wdr78 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4526302 1.0 ug DNA
EUR 154

Wdr78 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4526303 1.0 ug DNA
EUR 154

Wdr78 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4526304 1.0 ug DNA
EUR 154

WDR78 Protein Vector (Mouse) (pPB-C-His)

PV247218 500 ng
EUR 1065

WDR78 Protein Vector (Mouse) (pPB-N-His)

PV247219 500 ng
EUR 1065

WDR78 Protein Vector (Mouse) (pPM-C-HA)

PV247220 500 ng
EUR 1065

WDR78 Protein Vector (Mouse) (pPM-C-His)

PV247221 500 ng
EUR 1065

WDR78 Protein Vector (Rat) (pPB-C-His)

PV316442 500 ng
EUR 1166

WDR78 Protein Vector (Rat) (pPB-N-His)

PV316443 500 ng
EUR 1166

WDR78 Protein Vector (Rat) (pPM-C-HA)

PV316444 500 ng
EUR 1166

WDR78 Protein Vector (Rat) (pPM-C-His)

PV316445 500 ng
EUR 1166

WDR78 Protein Vector (Human) (pPB-C-His)

PV059789 500 ng
EUR 481

WDR78 Protein Vector (Human) (pPB-N-His)

PV059790 500 ng
EUR 481

WDR78 Protein Vector (Human) (pPM-C-HA)

PV059791 500 ng
EUR 481

WDR78 Protein Vector (Human) (pPM-C-His)

PV059792 500 ng
EUR 481

WDR78 Protein Vector (Human) (pPB-C-His)

PV046309 500 ng
EUR 329

WDR78 Protein Vector (Human) (pPB-N-His)

PV046310 500 ng
EUR 329

WDR78 Protein Vector (Human) (pPM-C-HA)

PV046311 500 ng
EUR 329

WDR78 Protein Vector (Human) (pPM-C-His)

PV046312 500 ng
EUR 329

Wdr78 3'UTR Luciferase Stable Cell Line

TU122263 1.0 ml Ask for price

WDR78 3'UTR GFP Stable Cell Line

TU078449 1.0 ml
EUR 1394

Wdr78 3'UTR GFP Stable Cell Line

TU172263 1.0 ml Ask for price

Wdr78 3'UTR Luciferase Stable Cell Line

TU223372 1.0 ml Ask for price

WDR78 3'UTR Luciferase Stable Cell Line

TU028449 1.0 ml
EUR 1394

Wdr78 3'UTR GFP Stable Cell Line

TU273372 1.0 ml Ask for price

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)

20-abx09801620ulSystems
  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)

20-abx09802120ulSystems
  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean

C1634370 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA Probe Diluent Solution

AR0063 5mL
EUR 106

cDNA from Arteriosclerosis: Aorta

C1236012Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery

C1236013Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery

C1236013Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein

C1236020Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon

C1236090Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart

C1236122Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart

C1236122Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney

C1236142Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney

C1236142Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver

C1236149Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung

C1236152Ld-1 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung

C1236152Ld-2 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung

C1236152Ld-3 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung

C1236152Ld-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung

C1236152Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas

C1236188Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen

C1236246Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach

C1236248Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Tetro cDNA Synthesis Kit

BIO-65042 30 Reactions Ask for price

Tetro cDNA Synthesis Kit

BIO-65043 100 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053 50 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053/S Sample Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65054 250 Reactions Ask for price

OneScriptPlus cDNA Synthesis Kit

G235 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis Kit

G236 100 x 20 ul reactions
EUR 169

OneScriptPlus cDNA Synthesis SuperMix

G453 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis SuperMix

G454 100 x 20 ul reactions
EUR 169

circRNA cDNA Synthesis Kit

G627 25 rxn (20 ul/rxn)
EUR 309

Human eNOS cDNA probe

eNOS51-D-2 2 ug
EUR 445

Novo? Transcriptome cDNA Kit

M1167-100
EUR 952

Novo? Transcriptome cDNA Kit

M1167-25
EUR 441

Plant Tissue cDNA: Arabidopsis

PC34-310 10 rxn
EUR 415

WDR78 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV702027 1.0 ug DNA
EUR 450

WDR78 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV702031 1.0 ug DNA
EUR 450

WDR78 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV702032 1.0 ug DNA
EUR 450

WDR78 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV664135 1.0 ug DNA
EUR 1355

WDR78 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV664139 1.0 ug DNA
EUR 1355

WDR78 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV664140 1.0 ug DNA
EUR 1355

cDNA Synthesis SuperMix for qPCR

20-abx09801920ulSystems
  • EUR 690.00
  • EUR 565.00
  • 100 rxns ×20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

cDNA from Alzheimer's Disease: Brain

C1236035Alz 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Brain

C1236035Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Parkinson's Disease: Brain

C1236035Par 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dementia: Brain: Hippocampus

C1236052Dem 40 reactions
EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Depression: Brain: Hippocampus

C1236052Dep 40 reactions
EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Colon

C1236090Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Esophagus

C1236106Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Heart

C1236122Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Interventricular Septum

C1236130Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Kidney

C1236142Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Liver

C1236149Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Lung

C1236152Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pulmonary Embolism: Lung

C1236152Ld-5 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Diaphragm

C1236169Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Pancreas

C1236188Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Skin

C1236218Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Small Intestine

C1236226Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spinal Cord

C1236234Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Spleen

C1236246Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Human Tumor Tissue: Breast cDNA

HT05-090 10 rxn
EUR 415

Human Adult cDNA Tissue: Lung

HA-152 10 rxn
EUR 415

Human Adult cDNA Tissue: Skin

HA-218 10 rxn
EUR 415

Human Adult cDNA Tissue: Testis

HA-260 10 rxn
EUR 415

Total-Transcriptome cDNA Synthesis Kit

G904 25 reactions
EUR 224

Total-Transcriptome cDNA Synthesis Kit

G905 100 reactions
EUR 544

Mouse iNOS (macrophage) cDNA probe

iNOS61-D-2 2 ug
EUR 445

Evo? cDNA Kit (gDNA Removal)

M1166-100
EUR 381

Monkey (Rhesus) cDNA Tissue: Thyroid

MR34-265 10 rxn
EUR 415

Accuris qMax cDNA Synthesis Kit

PR2100-C-100 1 PC
EUR 337.75
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit

PR2100-C-25 1 PC
EUR 142.36
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit

PR2100-C-250 1 PC
EUR 711.77
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit

PR2100-C-S 1 PC
EUR 77.76
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

amfiRivert cDNA Synthesis Master Mix

R5101-050 50 rxns
EUR 415

amfiRivert cDNA Synthesis Master Mix

R5101-100 2X50 rxns
EUR 847

amfiRivert cDNA Synthesis Master Mix

R5101-200 4X50 rxns
EUR 1211

amfiRivet cDNA Synthesis 2X Buffer

R5102-050 500ul
EUR 134

amfiRivet cDNA Synthesis 2X Buffer

R5102-100 2x500ul
EUR 192

Human WD repeat- containing protein 78, WDR78 ELISA KIT

ELI-28748h 96 Tests
EUR 824

pCDH-CMV-MCS-EF1-Puro cDNA Vector cDNA Clon/Exp Vector [pre-packaged virus]

CD510VB-1 >1 x 10^6 IFUs
EUR 786
  • Category: Lentiviral Technology

All-in-One cDNA Synthesis SuperMix

B24403 200 ractions
EUR 456
Description: All-in-One cDNA Synthesis SuperMix contains all the necessary components pre-blended in one tube for reverse transcription.

All-in-One cDNA Synthesis SuperMix

B24408 1000 ractions
EUR 1453
Description: All-in-One cDNA Synthesis SuperMix contains all the necessary components pre-blended in one tube for reverse transcription.

AzuraQuant cDNA Synthesis Kit - 25 Reactions

AZ-1995 25 Reactions
EUR 153

AzuraQuant cDNA Synthesis Kit - 100 Reactions

AZ-1996 100 Reactions
EUR 372

miRNA First-Strand cDNA Synthesis SuperMix

abx098020-20rxns20ulSystems 20 rxns × 20 ul Systems
EUR 732
  • Shipped within 5-10 working days.

Fly First-Strand cDNA Synthesis SuperMix

20-abx09885820ulSystems
  • EUR 718.00
  • EUR 578.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

cDNA from Human Tumor Tissue: Adrenal

C1235004-10 10 reactions
EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Bladder

C1235010-10 10 reactions
EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Bone

C1235023-10 10 reactions
EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Brain

C1235035-10 10 reactions
EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Breast

C1235086 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Colon

C1235090 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Kidney

C1235142 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Liver

C1235149 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Lung

C1235152 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Lymphoma

C1235161-10 10 reactions
EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Mesenchymoma

C1235164-10 10 reactions
EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Nose

C1235178-10 10 reactions
EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Ovary

C1235183-10 10 reactions
EUR 494
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Pancreas

C1235188-10 10 reactions
EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Parathyroid

C1235189-10 10 reactions
EUR 494
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Prostate

C1235201-10 10 reactions
EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Rectum

C1235206-10 10 reactions
EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Skin

C1235218-10 10 reactions
EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Melanoma

C1235218A-10 10 reactions
EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Stomach

C1235248 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Uterus

C1235274 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Brain

C1236035Dia 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Multiple Sclerosis Disease: Brain

C1236035Msc 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Amygdala

C1236036Alz 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Cerebellum

C1236039Alz 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Hippocampus

C1236052Alz 40 reactions
EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Parkinson's Disease: Brain: Hippocampus

C1236052Par 40 reactions
EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Pons

C1236071Alz 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Thalamus

C1236079Alz 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Colon

C1236090Dia 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Esophagus

C1236106Dia 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Heart

C1236122Dia 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Congenital heart disease: Heart

C1236122Hd-3 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Coronary Artery Atherosclerosis: Heart

C1236122Hd-5 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Congestive Heart Failure: Heart

C1236122Hd-6 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart Atrium, left

C1236126Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart Atrium, right

C1236127Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart Ventricle, left

C1236138Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart Ventricle, right

C1236139Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Kidney

C1236142Dia 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Liver

C1236149Dia 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver: Left Lobe

C1236150Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver: Right Lobe

C1236151Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Lung

C1236152Dia 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Lymph Node

C1236161Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Pancreas

C1236188Dia 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Skin

C1236218Dia 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Small Intestine

C1236226Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Spinal Cord

C1236234Lcs 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Spleen

C1236246Dia 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
#cdna amd, #cdna avm, #cdna cds, #cdna definition, #cdna gel, #cdna kit, #cdna nick, #cdna nyc, #cdna sbs, #cdna stock price, #cdna stocks, #cdna synthesis, #cdna synthesis kit, #cdna synthesis pcr, #cdna synthesis protocol, #cdna.tv, #cdna2, #cdnacp, #cdnaf, #cdname, #cdnap, #nattrol controls, #nattrol ct/ng panel, #nattrol influenza a/b positive control sds, #nattrol vaginal panel zeptometrix