NEK6 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

NEK6 Polyclonal Antibody
ABP59444-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NEK6 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of NEK6 from Human, Mouse, Rat. This NEK6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NEK6 protein at amino acid sequence of 90-170
NEK6 Polyclonal Antibody
ABP59444-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NEK6 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of NEK6 from Human, Mouse, Rat. This NEK6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NEK6 protein at amino acid sequence of 90-170
NEK6 Polyclonal Antibody
ES10209-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NEK6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
NEK6 Polyclonal Antibody
ES10209-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NEK6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
NEK6 Rabbit pAb
A8481-100ul 100 ul
EUR 308
NEK6 Rabbit pAb
A8481-200ul 200 ul
EUR 459
NEK6 Rabbit pAb
A8481-20ul 20 ul
EUR 183
NEK6 Rabbit pAb
A8481-50ul 50 ul
EUR 223
NEK6 antibody
70R-18840 50 ul
EUR 435
Description: Rabbit polyclonal NEK6 antibody
NEK6 antibody
10R-4953 100 ul
EUR 726
Description: Mouse monoclonal NEK6 antibody
NEK6 antibody
10R-4954 100 ul
EUR 691
Description: Mouse monoclonal NEK6 antibody
NEK6 antibody
10R-4956 100 ul
EUR 691
Description: Mouse monoclonal NEK6 antibody
NEK6 Antibody
45255-100ul 100ul
EUR 252
NEK6 Antibody
45255-50ul 50ul
EUR 187
NEK6 Antibody
DF8259 200ul
EUR 304
Description: NEK6 Antibody detects endogenous levels of total NEK6.
NEK6 Antibody
1-CSB-PA015704GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NEK6. Recognizes NEK6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA
NEK6 antibody
70R-5777 50 ug
EUR 467
Description: Rabbit polyclonal NEK6 antibody
NEK6 Antibody
abx122675-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
NEK6 Antibody
ABD8259 100 ug
EUR 438
NEK6 Antibody
ABD8277 100 ug
EUR 438
Polyclonal NEK6 Antibody (C-Terminus)
APR02058G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEK6 (C-Terminus). This antibody is tested and proven to work in the following applications:
Serine/threonine-Protein Kinase Nek6 (NEK6) Antibody
20-abx005847
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Serine/threonine-Protein Kinase Nek6 (NEK6) Antibody
20-abx217109
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Serine/threonine-Protein Kinase Nek6 (NEK6) Antibody
abx033855-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Serine/threonine-Protein Kinase Nek6 (NEK6) Antibody
abx033855-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Nek6/ Rat Nek6 ELISA Kit
ELI-13801r 96 Tests
EUR 886
NEK6 Conjugated Antibody
C45255 100ul
EUR 397
Anti-NEK6 antibody
STJ110779 100 µl
EUR 277
Description: The protein encoded by this gene is a kinase required for progression through the metaphase portion of mitosis. Inhibition of the encoded protein can lead to apoptosis. This protein also can enhance tumorigenesis by suppressing tumor cell senescence. Several transcript variants encoding a few different isoforms have been found for this gene.
Anti-NEK6 antibody
STJ191367 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NEK6
NEK6 protein
30R-2831 5 ug
EUR 503
Description: Purified recombinant Human NEK6 protein
NEK6, Active
7716-5
EUR 370
NEK6 siRNA
20-abx903526
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NEK6 siRNA
20-abx925722
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NEK6 siRNA
20-abx925723
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pOTB7-NEK6
PVT18482 2 ug
EUR 231
anti-NEK6
YF-PA25669 50 ul
EUR 334
Description: Mouse polyclonal to NEK6
NEK6 Blocking Peptide
33R-3041 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NEK6 antibody, catalog no. 70R-5777
NEK6 Blocking Peptide
DF8259-BP 1mg
EUR 195
NEK6 cloning plasmid
CSB-CL872543HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 942
  • Sequence: atggcaggacagcccggccacatgccccatggagggagttccaacaacctctgccacaccctggggcctgtgcatcctcctgacccacagaggcatcccaacacgctgtcttttcgctgctcgctggcggacttccagatcgaaaagaagataggccgaggacagttcagcgaggt
  • Show more
Description: A cloning plasmid for the NEK6 gene.
Anti-NEK6 (3B5)
YF-MA17486 100 ug
EUR 363
Description: Mouse monoclonal to NEK6
Anti-NEK6 (2A7)
YF-MA17487 50 ug
EUR 363
Description: Mouse monoclonal to NEK6
Anti-NEK6 (4B10)
YF-MA17488 200 ul
EUR 363
Description: Mouse monoclonal to NEK6
Porcine Serine/threonine- protein kinase Nek6, NEK6 ELISA KIT
ELI-16455p 96 Tests
EUR 928
Human Serine/threonine- protein kinase Nek6, NEK6 ELISA KIT
ELI-23244h 96 Tests
EUR 824
Mouse Serine/threonine- protein kinase Nek6, Nek6 ELISA KIT
ELI-39577m 96 Tests
EUR 865
Rat NEK6 shRNA Plasmid
20-abx990026
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse NEK6 shRNA Plasmid
20-abx975188
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human NEK6 shRNA Plasmid
20-abx957348
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
h NEK6 Expression Lentivirus
LVP1182 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for human target: NEK6, containing a RFP-Blasticidin dual selection marker.
Nek6 ORF Vector (Rat) (pORF)
ORF071225 1.0 ug DNA
EUR 506
h NEK6 inducible lentiviral particles
LVP230 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, NEK6, is fully sequence verified and matched to NCBI accession ID: NM_014397.4
NEK6 ORF Vector (Human) (pORF)
ORF007023 1.0 ug DNA
EUR 95
Nek6 ORF Vector (Mouse) (pORF)
ORF051222 1.0 ug DNA
EUR 506
Nek6 ORF Vector (Mouse) (pORF)
ORF051223 1.0 ug DNA
EUR 506
Nek6 sgRNA CRISPR Lentivector set (Mouse)
K4956201 3 x 1.0 ug
EUR 339
Nek6 sgRNA CRISPR Lentivector set (Rat)
K7399701 3 x 1.0 ug
EUR 339
NEK6 sgRNA CRISPR Lentivector set (Human)
K1416801 3 x 1.0 ug
EUR 339
Nek6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4956202 1.0 ug DNA
EUR 154
Nek6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4956203 1.0 ug DNA
EUR 154
Nek6 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4956204 1.0 ug DNA
EUR 154
Nek6 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7399702 1.0 ug DNA
EUR 154
Nek6 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7399703 1.0 ug DNA
EUR 154
Nek6 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7399704 1.0 ug DNA
EUR 154
NEK6 sgRNA CRISPR Lentivector (Human) (Target 1)
K1416802 1.0 ug DNA
EUR 154
NEK6 sgRNA CRISPR Lentivector (Human) (Target 2)
K1416803 1.0 ug DNA
EUR 154
NEK6 sgRNA CRISPR Lentivector (Human) (Target 3)
K1416804 1.0 ug DNA
EUR 154
NEK6 Protein Vector (Mouse) (pPB-C-His)
PV204886 500 ng
EUR 603
NEK6 Protein Vector (Mouse) (pPB-N-His)
PV204887 500 ng
EUR 603
NEK6 Protein Vector (Mouse) (pPM-C-HA)
PV204888 500 ng
EUR 603
NEK6 Protein Vector (Mouse) (pPM-C-His)
PV204889 500 ng
EUR 603
NEK6 Protein Vector (Mouse) (pPB-C-His)
PV204890 500 ng
EUR 603
NEK6 Protein Vector (Mouse) (pPB-N-His)
PV204891 500 ng
EUR 603
NEK6 Protein Vector (Mouse) (pPM-C-HA)
PV204892 500 ng
EUR 603
NEK6 Protein Vector (Mouse) (pPM-C-His)
PV204893 500 ng
EUR 603
NEK6 Protein Vector (Rat) (pPB-C-His)
PV284898 500 ng
EUR 603
NEK6 Protein Vector (Rat) (pPB-N-His)
PV284899 500 ng
EUR 603
NEK6 Protein Vector (Rat) (pPM-C-HA)
PV284900 500 ng
EUR 603
NEK6 Protein Vector (Rat) (pPM-C-His)
PV284901 500 ng
EUR 603
NEK6 Protein Vector (Human) (pPB-C-His)
PV028089 500 ng
EUR 329
NEK6 Protein Vector (Human) (pPB-N-His)
PV028090 500 ng
EUR 329
NEK6 Protein Vector (Human) (pPM-C-HA)
PV028091 500 ng
EUR 329
NEK6 Protein Vector (Human) (pPM-C-His)
PV028092 500 ng
EUR 329
Nek6 3'UTR Luciferase Stable Cell Line
TU113990 1.0 ml Ask for price
Nek6 3'UTR GFP Stable Cell Line
TU163990 1.0 ml Ask for price
Nek6 3'UTR Luciferase Stable Cell Line
TU213886 1.0 ml Ask for price
Nek6 3'UTR GFP Stable Cell Line
TU263886 1.0 ml Ask for price
NEK6 3'UTR GFP Stable Cell Line
TU065574 1.0 ml
EUR 1521
NEK6 3'UTR Luciferase Stable Cell Line
TU015574 1.0 ml
EUR 1521
NEK6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV663463 1.0 ug DNA
EUR 514
NEK6 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV663467 1.0 ug DNA
EUR 514
NEK6 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV663468 1.0 ug DNA
EUR 514
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

NEK6 Rabbit Polyclonal Antibody