NETO2 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

NETO2 Polyclonal Antibody

ES9926-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NETO2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NETO2 Polyclonal Antibody

ES9926-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NETO2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NETO2 antibody

70R-18847 50 ul
EUR 435
Description: Rabbit polyclonal NETO2 antibody

NETO2 Antibody

45235-100ul 100ul
EUR 252

NETO2 Antibody

45235-50ul 50ul
EUR 187

NETO2 Antibody

1-CSB-PA818759LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NETO2. Recognizes NETO2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

NETO2 Antibody

DF8195 200ul
EUR 304
Description: NETO2 Antibody detects endogenous levels of total NETO2.

NETO2 Antibody

1-CSB-PA015716GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NETO2. Recognizes NETO2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NETO2 Antibody

ABD8195 100 ug
EUR 438

Polyclonal NETO2 Antibody (N-term )

AMM06612G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NETO2 (N-term ). This antibody is tested and proven to work in the following applications:

NETO2 Polyclonal Antibody, HRP Conjugated

A66215 100 µg
EUR 570.55
Description: Ask the seller for details

NETO2 Polyclonal Antibody, FITC Conjugated

A66216 100 µg
EUR 570.55
Description: The best epigenetics products

NETO2 Polyclonal Antibody, Biotin Conjugated

A66217 100 µg
EUR 570.55
Description: kits suitable for this type of research

Neto2/ Rat Neto2 ELISA Kit

ELI-23196r 96 Tests
EUR 886

NETO2 Conjugated Antibody

C45235 100ul
EUR 397

anti- NETO2 antibody

FNab05666 100µg
EUR 548.75
  • Immunogen: neuropilin(NRP) and tolloid(TLL)-like 2
  • Uniprot ID: Q8NC67
  • Gene ID: 81831
  • Research Area: Neuroscience
Description: Antibody raised against NETO2

Anti-NETO2 antibody

PAab05666 100 ug
EUR 386

Anti-NETO2 antibody

STJ191084 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NETO2

NETO2 siRNA

20-abx903532
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NETO2 siRNA

20-abx925753
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NETO2 siRNA

20-abx925754
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-NETO2

YF-PA21183 50 ug
EUR 363
Description: Mouse polyclonal to NETO2

anti-NETO2

YF-PA21184 100 ug
EUR 403
Description: Rabbit polyclonal to NETO2

NETO2 Antibody, HRP conjugated

1-CSB-PA818759LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NETO2. Recognizes NETO2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NETO2 Antibody, FITC conjugated

1-CSB-PA818759LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NETO2. Recognizes NETO2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NETO2 Antibody, Biotin conjugated

1-CSB-PA818759LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NETO2. Recognizes NETO2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NETO2 Blocking Peptide

DF8195-BP 1mg
EUR 195

NETO2 cloning plasmid

CSB-CL818759HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 447
  • Sequence: atggcttgcaaaaccgcttttaataaaaccgggttccaagaagtgtttgatcctcctcattatgaactgttttcactaagggacaaagagatttctgcagacctggcagacttgtcggaagaattggacaactaccagaagatgcggcgctcctccaccgcctcccgctgcatcca
  • Show more
Description: A cloning plasmid for the NETO2 gene.

Anti-NETO2 (3E3)

YF-MA19457 100 ug
EUR 363
Description: Mouse monoclonal to NETO2

NETO2 ELISA KIT|Human

EF001181 96 Tests
EUR 689

Rat NETO2 shRNA Plasmid

20-abx989446
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NETO2 shRNA Plasmid

20-abx978254
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NETO2 shRNA Plasmid

20-abx963055
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NETO2 Recombinant Protein (Human)

RP021082 100 ug Ask for price

NETO2 Recombinant Protein (Mouse)

RP153725 100 ug Ask for price

NETO2 Recombinant Protein (Rat)

RP213707 100 ug Ask for price

Neuropilin And Tolloid Like 2 (NETO2) Antibody

20-abx217116
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin And Tolloid Like 2 (NETO2) Antibody

20-abx308758
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin And Tolloid Like 2 (NETO2) Antibody

abx235666-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Neto2 ORF Vector (Rat) (pORF)

ORF071237 1.0 ug DNA
EUR 506

NETO2 ORF Vector (Human) (pORF)

ORF007028 1.0 ug DNA
EUR 95

Neto2 ORF Vector (Mouse) (pORF)

ORF051243 1.0 ug DNA
EUR 506

pCMV-SPORT6-NETO2(734-1557bp)

PVT13531 2 ug
EUR 391

Neuropilin And Tolloid Like 2 (NETO2) Antibody (HRP)

20-abx308759
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin And Tolloid Like 2 (NETO2) Antibody (FITC)

20-abx308760
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin And Tolloid Like 2 (NETO2) Antibody (Biotin)

20-abx308761
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NETO2 Rabbit Polyclonal Antibody