NID2 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

NID2 Polyclonal Antibody
ABP59465-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780
  • Applications tips:
Description: A polyclonal antibody for detection of NID2 from Human. This NID2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780
NID2 Polyclonal Antibody
ABP59465-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780
  • Applications tips:
Description: A polyclonal antibody for detection of NID2 from Human. This NID2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780
NID2 Polyclonal Antibody
ES9927-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NID2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
NID2 Polyclonal Antibody
ES9927-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NID2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
Human Nidogen 2 (NID2) ELISA Kit
DLR-NID2-Hu-48T 48T
EUR 517
  • Should the Human Nidogen 2 (NID2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nidogen 2 (NID2) in samples from serum, plasma or other biological fluids.
Human Nidogen 2 (NID2) ELISA Kit
DLR-NID2-Hu-96T 96T
EUR 673
  • Should the Human Nidogen 2 (NID2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nidogen 2 (NID2) in samples from serum, plasma or other biological fluids.
Rat Nidogen 2 (NID2) ELISA Kit
DLR-NID2-Ra-48T 48T
EUR 549
  • Should the Rat Nidogen 2 (NID2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nidogen 2 (NID2) in samples from serum, plasma or other biological fluids.
Rat Nidogen 2 (NID2) ELISA Kit
DLR-NID2-Ra-96T 96T
EUR 718
  • Should the Rat Nidogen 2 (NID2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nidogen 2 (NID2) in samples from serum, plasma or other biological fluids.
Human Nidogen 2 (NID2) ELISA Kit
RDR-NID2-Hu-48Tests 48 Tests
EUR 544
Human Nidogen 2 (NID2) ELISA Kit
RDR-NID2-Hu-96Tests 96 Tests
EUR 756
Rat Nidogen 2 (NID2) ELISA Kit
RDR-NID2-Ra-48Tests 48 Tests
EUR 583
Rat Nidogen 2 (NID2) ELISA Kit
RDR-NID2-Ra-96Tests 96 Tests
EUR 811
Human Nidogen 2 (NID2) ELISA Kit
RD-NID2-Hu-48Tests 48 Tests
EUR 521
Human Nidogen 2 (NID2) ELISA Kit
RD-NID2-Hu-96Tests 96 Tests
EUR 723
Rat Nidogen 2 (NID2) ELISA Kit
RD-NID2-Ra-48Tests 48 Tests
EUR 557
Rat Nidogen 2 (NID2) ELISA Kit
RD-NID2-Ra-96Tests 96 Tests
EUR 775
NID2 antibody
70R-18878 50 ul
EUR 435
Description: Rabbit polyclonal NID2 antibody
NID2 Antibody
46097-100ul 100ul
EUR 252
NID2 Antibody
46097-50ul 50ul
EUR 187
NID2 Antibody
DF9704 200ul
EUR 304
Description: NID2 Antibody detects endogenous levels of total NID2.
NID2 Antibody
1-CSB-PA015803GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NID2. Recognizes NID2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
NID2 antibody
70R-6064 50 ug
EUR 467
Description: Rabbit polyclonal NID2 antibody
NID2 Antibody
ABD9704 100 ug
EUR 438
Nidogen 2 (NID2) Polyclonal Antibody (Human)
4-PAF416Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2)
NID2 Conjugated Antibody
C46097 100ul
EUR 397
Anti-NID2 antibody
STJ191085 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NID2
Nidogen 2 (NID2) Polyclonal Antibody (Human), APC
4-PAF416Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with APC.
Nidogen 2 (NID2) Polyclonal Antibody (Human), Biotinylated
4-PAF416Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with Biotin.
Nidogen 2 (NID2) Polyclonal Antibody (Human), Cy3
4-PAF416Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with Cy3.
Nidogen 2 (NID2) Polyclonal Antibody (Human), FITC
4-PAF416Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with FITC.
Nidogen 2 (NID2) Polyclonal Antibody (Human), HRP
4-PAF416Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with HRP.
Nidogen 2 (NID2) Polyclonal Antibody (Human), PE
4-PAF416Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with PE.
NID2 siRNA
20-abx903561
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NID2 siRNA
20-abx925899
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NID2 siRNA
20-abx925900
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Nidogen 2 (NID2) Antibody
abx022770-20ul 20 ul
EUR 398
  • Shipped within 5-10 working days.
Nidogen 2 (NID2) Antibody
20-abx177809
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.
Nidogen 2 (NID2) Antibody
20-abx121180
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Nidogen 2 (NID2) Antibody
20-abx128335
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Nidogen 2 (NID2) Antibody
20-abx173827
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Nidogen 2 (NID2) Antibody
20-abx173828
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
Nidogen 2 (NID2) Antibody
abx235730-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Nidogen 2 (NID2) Antibody
abx235731-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Nidogen 2 (NID2) Polyclonal Antibody (Human), APC-Cy7
4-PAF416Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with APC-Cy7.
NID2 Blocking Peptide
33R-1881 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NID2 antibody, catalog no. 70R-6064
NID2 Blocking Peptide
DF9704-BP 1mg
EUR 195
NID2 cloning plasmid
CSB-CL614513HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2910
  • Sequence: atggagggggaccgggtggccgggcggccggtgctgtcgtcgttaccagtgctactgctgctgcagttgctaatgttgcgggccgcggcgctgcacccagacgagctcttcccacacggggagtcgtggggggaccagctcctgcaggaaggcgacgacgaaagctcagccgtgg
  • Show more
Description: A cloning plasmid for the NID2 gene.

NID2 Rabbit Polyclonal Antibody