NLK Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

NLK Polyclonal Antibody

ABP59480-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NLK protein at amino acid sequence of 230-310
  • Applications tips:
Description: A polyclonal antibody for detection of NLK from Human, Mouse, Rat. This NLK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NLK protein at amino acid sequence of 230-310

NLK Polyclonal Antibody

ABP59480-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NLK protein at amino acid sequence of 230-310
  • Applications tips:
Description: A polyclonal antibody for detection of NLK from Human, Mouse, Rat. This NLK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NLK protein at amino acid sequence of 230-310

NLK Rabbit pAb

A3190-100ul 100 ul
EUR 308

NLK Rabbit pAb

A3190-200ul 200 ul
EUR 459

NLK Rabbit pAb

A3190-20ul 20 ul
EUR 183

NLK Rabbit pAb

A3190-50ul 50 ul
EUR 223

NLK antibody

70R-9450 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal NLK antibody

NLK Antibody

ABD7243 100 ug
EUR 438

NLK Antibody

ABD7575 100 ug
EUR 438

NLK antibody

38629-100ul 100ul
EUR 252

NLK antibody

23128-100ul 100ul
EUR 390

NLK antibody

70R-13123 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal NLK antibody

NLK Antibody

DF7243 200ul
EUR 304
Description: NLK Antibody detects endogenous levels of total NLK.

NLK Antibody

DF7575 200ul
EUR 304
Description: NLK Antibody detects endogenous levels of total NLK.

NLK Antibody

1-CSB-PA890657ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NLK. Recognizes NLK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NLK Antibody

1-CSB-PA890657ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NLK. Recognizes NLK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

Polyclonal NLK Antibody (C-term)

APR17584G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NLK (C-term). This antibody is tested and proven to work in the following applications:

Serine/threonine-Protein Kinase NLK (NLK) Antibody

20-abx125032
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase NLK (NLK) Antibody

20-abx002290
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase NLK (NLK) Antibody

abx034924-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase NLK (NLK) Antibody

abx034924-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase NLK (NLK) Antibody

abx033464-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase NLK (NLK) Antibody

abx033464-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase NLK (NLK) Antibody

20-abx320761
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase NLK (NLK) Antibody

20-abx321819
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nlk/ Rat Nlk ELISA Kit

ELI-15097r 96 Tests
EUR 886

NLK Conjugated Antibody

C38629 100ul
EUR 397

Monoclonal NLK Antibody

APR17825G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human NLK. The antibodies are raised in Mouse. This antibody is applicable in WB

NLK-T286 Antibody

abx033465-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

NLK-T286 Antibody

abx033465-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Anti-NLK antibody

STJ24772 100 µl
EUR 277

Anti-NLK antibody

STJ191357 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NLK

NLK siRNA

20-abx903574
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NLK siRNA

20-abx926002
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NLK siRNA

20-abx926003
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-NLK

YF-PA19168 50 ug
EUR 363
Description: Mouse polyclonal to NLK

anti-NLK

YF-PA26210 50 ul
EUR 334
Description: Mouse polyclonal to NLK

NLK Blocking Peptide

33R-8051 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NLK antibody, catalog no. 70R-9450

NLK Blocking Peptide

DF7243-BP 1mg
EUR 195

NLK Blocking Peptide

DF7575-BP 1mg
EUR 195

NLK cloning plasmid

CSB-CL890657HU-10ug 10ug
EUR 544
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1548
  • Sequence: atggcggcttacaatggcggtacatctgcagcagcaacaggtcaccaccaccaccatcaccaccaccttccacacctccctcctcctcacctgcaccaccaccaccaccctcaacaccatcttcatccggggtcggctgccgctgtacaccctgtacagcagcacacctcttcgg
  • Show more
Description: A cloning plasmid for the NLK gene.

Anti-NLK (1C1)

YF-MA18555 100 ug
EUR 363
Description: Mouse monoclonal to NLK

Anti-NLK (2B11)

YF-MA18556 100 ug
EUR 363
Description: Mouse monoclonal to NLK

Monoclonal NLK Antibody, Clone: 1146CT24.2.1

APR17583G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human NLK. The antibodies are raised in Mouse and are from clone 1146CT24.2.1. This antibody is applicable in WB, E

Mouse Serine/threonine- protein kinase NLK, Nlk ELISA KIT

ELI-15096m 96 Tests
EUR 865

Human Serine/threonine- protein kinase NLK, NLK ELISA KIT

ELI-44037h 96 Tests
EUR 824

Bovine Serine/threonine- protein kinase NLK, NLK ELISA KIT

ELI-38287b 96 Tests
EUR 928

Human Serine/threonine-protein kinase NLK (NLK) ELISA Kit

abx385203-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Serine/threonine-protein kinase NLK (NLK) ELISA Kit

abx390000-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Serine/threonine-protein kinase NLK (NLK) ELISA Kit

abx391676-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Nlk ELISA Kit| Mouse Serine/threonine-protein kinase NLK ELISA

EF015639 96 Tests
EUR 689

NLK ELISA Kit| Bovine Serine/threonine-protein kinase NLK ELISA

EF011651 96 Tests
EUR 689

NLK ELISA KIT|Human

EF005330 96 Tests
EUR 689

Canine NLK ELISA KIT

ELI-39621d 96 Tests
EUR 928

Human NLK shRNA Plasmid

20-abx959907
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NLK shRNA Plasmid

20-abx971760
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NLK shRNA Plasmid

20-abx990833
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Nlk ELISA Kit| Rat Serine/threonine-protein kinase NLK ELISA Ki

EF019036 96 Tests
EUR 689

NLK ORF Vector (Human) (pORF)

ORF007104 1.0 ug DNA
EUR 95

Nlk ORF Vector (Rat) (pORF)

ORF071352 1.0 ug DNA
EUR 506

Nlk ORF Vector (Mouse) (pORF)

ORF051433 1.0 ug DNA
EUR 506

NLK sgRNA CRISPR Lentivector set (Human)

K1432801 3 x 1.0 ug
EUR 339

Nlk sgRNA CRISPR Lentivector set (Mouse)

K4852401 3 x 1.0 ug
EUR 339

Nlk sgRNA CRISPR Lentivector set (Rat)

K6643801 3 x 1.0 ug
EUR 339

NLK sgRNA CRISPR Lentivector (Human) (Target 1)

K1432802 1.0 ug DNA
EUR 154

NLK sgRNA CRISPR Lentivector (Human) (Target 2)

K1432803 1.0 ug DNA
EUR 154

NLK sgRNA CRISPR Lentivector (Human) (Target 3)

K1432804 1.0 ug DNA
EUR 154

Nlk sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4852402 1.0 ug DNA
EUR 154

Nlk sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4852403 1.0 ug DNA
EUR 154

Nlk sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4852404 1.0 ug DNA
EUR 154

Nlk sgRNA CRISPR Lentivector (Rat) (Target 1)

K6643802 1.0 ug DNA
EUR 154

Nlk sgRNA CRISPR Lentivector (Rat) (Target 2)

K6643803 1.0 ug DNA
EUR 154

Nlk sgRNA CRISPR Lentivector (Rat) (Target 3)

K6643804 1.0 ug DNA
EUR 154

NLK Protein Vector (Rat) (pPB-C-His)

PV285406 500 ng
EUR 603

NLK Protein Vector (Rat) (pPB-N-His)

PV285407 500 ng
EUR 603

NLK Protein Vector (Rat) (pPM-C-HA)

PV285408 500 ng
EUR 603

NLK Protein Vector (Rat) (pPM-C-His)

PV285409 500 ng
EUR 603

NLK Protein Vector (Human) (pPB-C-His)

PV028413 500 ng
EUR 329

NLK Protein Vector (Human) (pPB-N-His)

PV028414 500 ng
EUR 329

NLK Protein Vector (Human) (pPM-C-HA)

PV028415 500 ng
EUR 329

NLK Protein Vector (Human) (pPM-C-His)

PV028416 500 ng
EUR 329

NLK Protein Vector (Mouse) (pPB-C-His)

PV205730 500 ng
EUR 603

NLK Protein Vector (Mouse) (pPB-N-His)

PV205731 500 ng
EUR 603

NLK Protein Vector (Mouse) (pPM-C-HA)

PV205732 500 ng
EUR 603

NLK Protein Vector (Mouse) (pPM-C-His)

PV205733 500 ng
EUR 603

NLK Rabbit Polyclonal Antibody