NOL9 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

NOL9 Polyclonal Antibody

ABP59495-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NOL9 protein at amino acid sequence of 640-720
  • Applications tips:
Description: A polyclonal antibody for detection of NOL9 from Human, Mouse. This NOL9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOL9 protein at amino acid sequence of 640-720

NOL9 Rabbit pAb

A9160-100ul 100 ul
EUR 308

NOL9 Rabbit pAb

A9160-200ul 200 ul
EUR 459

NOL9 Rabbit pAb

A9160-20ul 20 ul Ask for price

NOL9 Rabbit pAb

A9160-50ul 50 ul Ask for price

NOL9 Antibody

ABD9721 100 ug
EUR 438

NOL9 Antibody

36222-100ul 100ul
EUR 252

NOL9 Antibody

DF9721 200ul
EUR 304
Description: NOL9 Antibody detects endogenous levels of total NOL9.

NOL9 Antibody

1-CSB-PA150875
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NOL9. Recognizes NOL9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

Polyclonal NOL9 Antibody (C-term)

APR06213G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOL9 (C-term). This antibody is tested and proven to work in the following applications:

NOL9 Conjugated Antibody

C36222 100ul
EUR 397

anti- NOL9 antibody

FNab05789 100µg
EUR 585
  • Immunogen: nucleolar protein 9
  • Uniprot ID: Q5SY16
  • Gene ID: 79707
  • Research Area: Metabolism
Description: Antibody raised against NOL9

Anti-NOL9 antibody

PAab05789 100 ug
EUR 412

Anti-NOL9 antibody

STJ111591 100 µl
EUR 277

Anti-NOL9 antibody

STJ191116 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NOL9

NOL9 siRNA

20-abx926132
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NOL9 siRNA

20-abx926133
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NOL9 Blocking Peptide

DF9721-BP 1mg
EUR 195

NOL9 cloning plasmid

CSB-CL725557HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2109
  • Sequence: ATGGCGGACTCGGGACTGCTGCTAAAGTGGGGTTCCTGCCGTTCCACTTGGCTGCGGGTCCGCAAGGCCCGGCCCCAGCTCATCCTCAGCCGCCGGCCCCGCCGCCGGCTCGGGAGCCTGCGCTGGTGCGGTCGGCGGCGCCTACGGCGGCGGTTACTGCAAGCCCAGGCGGCCG
  • Show more
Description: A cloning plasmid for the NOL9 gene.

Nucleolar Protein 9 (NOL9) Antibody

20-abx124786
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Nucleolar Protein 9 (NOL9) Antibody

abx122121-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Nucleolar Protein 9 (NOL9) Antibody

abx034569-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Nucleolar Protein 9 (NOL9) Antibody

abx034569-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Nucleolar Protein 9 (NOL9) Antibody

abx235789-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Nucleolar Protein 9 (NOL9) Antibody

20-abx211330
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Polynucleotide 5'- hydroxyl- kinase NOL9, NOL9 ELISA KIT

ELI-15001h 96 Tests
EUR 824

Mouse Polynucleotide 5'- hydroxyl- kinase NOL9, Nol9 ELISA KIT

ELI-44124m 96 Tests
EUR 865

Bovine Polynucleotide 5'- hydroxyl- kinase NOL9, NOL9 ELISA KIT

ELI-44672b 96 Tests
EUR 928

Mouse NOL9 shRNA Plasmid

20-abx978066
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NOL9 ELISA KIT|Human

EF001279 96 Tests
EUR 689

Human NOL9 shRNA Plasmid

20-abx962501
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NOL9 Recombinant Protein (Human)

RP041680 100 ug Ask for price

NOL9 Recombinant Protein (Mouse)

RP154532 100 ug Ask for price

NOL9 Recombinant Protein (Mouse)

RP154535 100 ug Ask for price

NOL9 ORF Vector (Human) (pORF)

ORF013894 1.0 ug DNA
EUR 354

Nol9 ORF Vector (Mouse) (pORF)

ORF051512 1.0 ug DNA
EUR 506

Nol9 ORF Vector (Mouse) (pORF)

ORF051513 1.0 ug DNA
EUR 506

NOL9 sgRNA CRISPR Lentivector set (Human)

K1439401 3 x 1.0 ug
EUR 339

Nol9 sgRNA CRISPR Lentivector set (Mouse)

K4769401 3 x 1.0 ug
EUR 339

Human Nucleolar Protein 9 (NOL9) ELISA Kit

abx381843-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

NOL9 sgRNA CRISPR Lentivector (Human) (Target 1)

K1439402 1.0 ug DNA
EUR 154

NOL9 sgRNA CRISPR Lentivector (Human) (Target 2)

K1439403 1.0 ug DNA
EUR 154

NOL9 sgRNA CRISPR Lentivector (Human) (Target 3)

K1439404 1.0 ug DNA
EUR 154

Nol9 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4769402 1.0 ug DNA
EUR 154

Nol9 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4769403 1.0 ug DNA
EUR 154

Nol9 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4769404 1.0 ug DNA
EUR 154

NOL9 Protein Vector (Human) (pPB-C-His)

PV055573 500 ng
EUR 481

NOL9 Protein Vector (Human) (pPB-N-His)

PV055574 500 ng
EUR 481

NOL9 Protein Vector (Human) (pPM-C-HA)

PV055575 500 ng
EUR 481

NOL9 Protein Vector (Human) (pPM-C-His)

PV055576 500 ng
EUR 481

Human Nucleolar Protein 9(NOL9)ELISA Kit

QY-E03186 96T
EUR 361

NOL9 Protein Vector (Mouse) (pPB-C-His)

PV206046 500 ng
EUR 1065

NOL9 Protein Vector (Mouse) (pPB-N-His)

PV206047 500 ng
EUR 1065

NOL9 Protein Vector (Mouse) (pPM-C-HA)

PV206048 500 ng
EUR 1065

NOL9 Protein Vector (Mouse) (pPM-C-His)

PV206049 500 ng
EUR 1065

NOL9 Protein Vector (Mouse) (pPB-C-His)

PV206050 500 ng
EUR 1065

NOL9 Protein Vector (Mouse) (pPB-N-His)

PV206051 500 ng
EUR 1065

NOL9 Protein Vector (Mouse) (pPM-C-HA)

PV206052 500 ng
EUR 1065

NOL9 Protein Vector (Mouse) (pPM-C-His)

PV206053 500 ng
EUR 1065

NOL9 3'UTR Luciferase Stable Cell Line

TU015809 1.0 ml
EUR 2333

NOL9 3'UTR GFP Stable Cell Line

TU065809 1.0 ml
EUR 2333

Nol9 3'UTR GFP Stable Cell Line

TU264075 1.0 ml Ask for price

Nol9 3'UTR Luciferase Stable Cell Line

TU214075 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NOL9 Rabbit Polyclonal Antibody