NOP14 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

NOP14 Polyclonal Antibody
ES9955-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NOP14 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
NOP14 Polyclonal Antibody
ABP59496-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860
  • Applications tips:
Description: A polyclonal antibody for detection of NOP14 from Human, Mouse. This NOP14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860
NOP14 Polyclonal Antibody
ABP59496-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860
  • Applications tips:
Description: A polyclonal antibody for detection of NOP14 from Human, Mouse. This NOP14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860
NOP14 Polyclonal Antibody
ABP59496-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860
  • Applications tips:
Description: A polyclonal antibody for detection of NOP14 from Human, Mouse. This NOP14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860
NOP14 Polyclonal Antibody
27397-100ul 100ul
EUR 252
NOP14 Polyclonal Antibody
27397-50ul 50ul
EUR 187
NOP14 Rabbit pAb
A10361-100ul 100 ul
EUR 308
NOP14 Rabbit pAb
A10361-200ul 200 ul
EUR 459
NOP14 Rabbit pAb
A10361-20ul 20 ul
EUR 183
NOP14 Rabbit pAb
A10361-50ul 50 ul
EUR 223
NOP14 Polyclonal Conjugated Antibody
C27397 100ul
EUR 397
NOP14 Antibody
20-abx126263
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Anti-NOP14 antibody
STJ112398 100 µl
EUR 277
Description: This gene encodes a protein that plays a role in pre-18s rRNA processing and small ribosomal subunit assembly. The encoded protein may be involved in the regulation of pancreatic cancer cell proliferation and migration. Alternative splicing results in multiple transcript variants.
Anti-NOP14 antibody
STJ191113 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NOP14
NOP14 siRNA
20-abx926146
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NOP14 siRNA
20-abx926147
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NOP14 cloning plasmid
CSB-CL015936HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2421
  • Sequence: atggcgaaggcgaagaaggtcggggcgcgaaggaaggcctccggggcgccggcgggagcgcgagggggcccggcgaaggccaactccaatccgttcgaggtgaaagttaacaggcagaagttccagatcctgggccggaagacgcgccacgacgtgggactgcccggggtgtctc
  • Show more
Description: A cloning plasmid for the NOP14 gene.
pDONR223-NOP14 Plasmid
PVTB00924 2 ug
EUR 356
Mouse NOP14 shRNA Plasmid
20-abx978393
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human NOP14 shRNA Plasmid
20-abx955650
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
pCD513B-1-NOP14 Plasmid
PVTB00924-4a 2 ug
EUR 356
NOP14 ORF Vector (Human) (pORF)
ORF007154 1.0 ug DNA
EUR 95
Nop14 ORF Vector (Rat) (pORF)
ORF071407 1.0 ug DNA
EUR 506
Nop14 ORF Vector (Mouse) (pORF)
ORF051523 1.0 ug DNA
EUR 506
NOP14 sgRNA CRISPR Lentivector set (Human)
K1440601 3 x 1.0 ug
EUR 339
Nop14 sgRNA CRISPR Lentivector set (Mouse)
K3839701 3 x 1.0 ug
EUR 339
Nop14 sgRNA CRISPR Lentivector set (Rat)
K6634701 3 x 1.0 ug
EUR 339
NOP14-AS1 ORF Vector (Human) (pORF)
ORF026175 1.0 ug DNA Ask for price
Human Nucleolar protein 14, NOP14 ELISA KIT
ELI-16701h 96 Tests
EUR 824
Mouse Nucleolar protein 14, Nop14 ELISA KIT
ELI-44673m 96 Tests
EUR 865
NOP14 sgRNA CRISPR Lentivector (Human) (Target 1)
K1440602 1.0 ug DNA
EUR 154
NOP14 sgRNA CRISPR Lentivector (Human) (Target 2)
K1440603 1.0 ug DNA
EUR 154
NOP14 sgRNA CRISPR Lentivector (Human) (Target 3)
K1440604 1.0 ug DNA
EUR 154
Nop14 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3839702 1.0 ug DNA
EUR 154
Nop14 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3839703 1.0 ug DNA
EUR 154
Nop14 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3839704 1.0 ug DNA
EUR 154
Nop14 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6634702 1.0 ug DNA
EUR 154
Nop14 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6634703 1.0 ug DNA
EUR 154
Nop14 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6634704 1.0 ug DNA
EUR 154
NOP14 Protein Vector (Human) (pPB-C-His)
PV028613 500 ng
EUR 329
NOP14 Protein Vector (Human) (pPB-N-His)
PV028614 500 ng
EUR 329
NOP14 Protein Vector (Human) (pPM-C-HA)
PV028615 500 ng
EUR 329
NOP14 Protein Vector (Human) (pPM-C-His)
PV028616 500 ng
EUR 329
NOP14 Protein Vector (Mouse) (pPB-C-His)
PV206090 500 ng
EUR 1065
NOP14 Protein Vector (Mouse) (pPB-N-His)
PV206091 500 ng
EUR 1065
NOP14 Protein Vector (Mouse) (pPM-C-HA)
PV206092 500 ng
EUR 1065
NOP14 Protein Vector (Mouse) (pPM-C-His)
PV206093 500 ng
EUR 1065
NOP14 Protein Vector (Rat) (pPB-C-His)
PV285626 500 ng
EUR 603
NOP14 Protein Vector (Rat) (pPB-N-His)
PV285627 500 ng
EUR 603
NOP14 Protein Vector (Rat) (pPM-C-HA)
PV285628 500 ng
EUR 603
NOP14 Protein Vector (Rat) (pPM-C-His)
PV285629 500 ng
EUR 603
Nop14 3'UTR GFP Stable Cell Line
TU164208 1.0 ml Ask for price
NOP14 3'UTR Luciferase Stable Cell Line
TU015821 1.0 ml
EUR 1394
Nop14 3'UTR Luciferase Stable Cell Line
TU114208 1.0 ml Ask for price
NOP14 3'UTR GFP Stable Cell Line
TU065821 1.0 ml
EUR 1394
Nop14 3'UTR GFP Stable Cell Line
TU264081 1.0 ml Ask for price
Nop14 3'UTR Luciferase Stable Cell Line
TU214081 1.0 ml Ask for price
NOP14 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV621619 1.0 ug DNA
EUR 682
NOP14 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV621623 1.0 ug DNA
EUR 682
NOP14 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV621624 1.0 ug DNA
EUR 682
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NOP14 Rabbit Polyclonal Antibody