NOSIP Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

NOSIP Polyclonal Antibody

ES9929-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NOSIP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NOSIP Polyclonal Antibody

ES9929-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NOSIP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NOSIP Rabbit pAb

A10024-100ul 100 ul
EUR 308

NOSIP Rabbit pAb

A10024-200ul 200 ul
EUR 459

NOSIP Rabbit pAb

A10024-20ul 20 ul
EUR 183

NOSIP Rabbit pAb

A10024-50ul 50 ul
EUR 223

Human Nitric Oxide Synthase Interacting Protein (NOSIP) ELISA Kit

DLR-NOSIP-Hu-48T 48T
EUR 479
  • Should the Human Nitric Oxide Synthase Interacting Protein (NOSIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nitric Oxide Synthase Interacting Protein (NOSIP) in samples from tissue homogenates or other biological fluids.

Human Nitric Oxide Synthase Interacting Protein (NOSIP) ELISA Kit

DLR-NOSIP-Hu-96T 96T
EUR 621
  • Should the Human Nitric Oxide Synthase Interacting Protein (NOSIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nitric Oxide Synthase Interacting Protein (NOSIP) in samples from tissue homogenates or other biological fluids.

Human Nitric Oxide Synthase Interacting Protein (NOSIP) ELISA Kit

RDR-NOSIP-Hu-48Tests 48 Tests
EUR 500

Human Nitric Oxide Synthase Interacting Protein (NOSIP) ELISA Kit

RDR-NOSIP-Hu-96Tests 96 Tests
EUR 692

Human Nitric Oxide Synthase Interacting Protein (NOSIP) ELISA Kit

RD-NOSIP-Hu-48Tests 48 Tests
EUR 478

Human Nitric Oxide Synthase Interacting Protein (NOSIP) ELISA Kit

RD-NOSIP-Hu-96Tests 96 Tests
EUR 662

NOSIP antibody

22497-100ul 100ul
EUR 390

NOSIP antibody

70R-13464 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal NOSIP antibody

NOSIP antibody

70R-2310 50 ug
EUR 467
Description: Rabbit polyclonal NOSIP antibody raised against the N terminal of NOSIP

NOSIP Antibody

47168-100ul 100ul
EUR 252

NOSIP antibody

70R-9442 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal NOSIP antibody

NOSIP antibody

PAab09881 100 ug
EUR 386

Polyclonal NOSIP Antibody (N-term)

APR17599G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOSIP (N-term). This antibody is tested and proven to work in the following applications:

NOSIP Conjugated Antibody

C47168 100ul
EUR 397

anti- NOSIP antibody

FNab09881 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • Immunogen: NOSIP
  • Uniprot ID: Q9Y314
  • Gene ID: 51070
  • Research Area: Signal Transduction
Description: Antibody raised against NOSIP

anti- NOSIP antibody

LSMab09881 100 ug
EUR 386

Anti-NOSIP antibody

STJ112064 100 µl
EUR 277
Description: The protein encoded by this gene may modulate the activity and localization of nitric oxide synthase (endothelial and neuronal) and thus nitric oxide production. Alternative splicing results in multiple transcript variants that encode the same protein.

Anti-NOSIP antibody

STJ191087 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NOSIP

NOSIP siRNA

20-abx926165
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NOSIP siRNA

20-abx926166
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-NOSIP

YF-PA18824 50 ul
EUR 363
Description: Mouse polyclonal to NOSIP

anti-NOSIP

YF-PA18825 50 ug
EUR 363
Description: Mouse polyclonal to NOSIP

NOSIP Blocking Peptide

33R-5448 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NOSIP antibody, catalog no. 70R-2310

NOSIP Blocking Peptide

33R-9499 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NOSIP antibody, catalog no. 70R-9442

NOSIP cloning plasmid

CSB-CL897477HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 906
  • Sequence: atgacgcggcatggcaagaactgcaccgcaggggccgtctacacctaccacgagaagaagaaggacacagcggcctcgggctatgggacccagaacattcgactgagccgggatgccgtgaaggacttcgactgctgttgtctctccctgcagccttgccacgatcctgttgtcac
  • Show more
Description: A cloning plasmid for the NOSIP gene.

NOSIP cloning plasmid

CSB-CL897477HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 906
  • Sequence: atgacgcggcatggcaagaactgcaccgcaggggccgtctacacctaccacgagaagaagaaggacacagcggcctcgggctatgggacccagaacattcgactgagccgggatgccgtgaaggacttcgactgctgttgtctctccctgcagccttgccacgatcctgttgtcac
  • Show more
Description: A cloning plasmid for the NOSIP gene.

Nitric Oxide Synthase Interacting Protein (NOSIP) Polyclonal Antibody (Human)

4-PAA330Hu01
  • EUR 232.00
  • EUR 2272.00
  • EUR 571.00
  • EUR 288.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOSIP (Gly62~Ser295)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Nitric Oxide Synthase Interacting Protein (NOSIP)

NOSIP ELISA KIT|Human

EF005362 96 Tests
EUR 689

Mouse NOSIP shRNA Plasmid

20-abx975581
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NOSIP shRNA Plasmid

20-abx959493
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NOSIP Recombinant Protein (Human)

RP021478 100 ug Ask for price

NOSIP Recombinant Protein (Human)

RP021481 100 ug Ask for price

NOSIP Recombinant Protein (Mouse)

RP154595 100 ug Ask for price

NOSIP Recombinant Protein (Mouse)

RP154598 100 ug Ask for price

NOSIP Recombinant Protein (Rat)

RP214244 100 ug Ask for price

Nitric Oxide Synthase Interacting Protein (NOSIP) Polyclonal Antibody (Human), APC

4-PAA330Hu01-APC
  • EUR 323.00
  • EUR 2951.00
  • EUR 831.00
  • EUR 407.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOSIP (Gly62~Ser295)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Nitric Oxide Synthase Interacting Protein (NOSIP). This antibody is labeled with APC.

Nitric Oxide Synthase Interacting Protein (NOSIP) Polyclonal Antibody (Human), Biotinylated

4-PAA330Hu01-Biotin
  • EUR 295.00
  • EUR 2222.00
  • EUR 668.00
  • EUR 357.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOSIP (Gly62~Ser295)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Nitric Oxide Synthase Interacting Protein (NOSIP). This antibody is labeled with Biotin.

Nitric Oxide Synthase Interacting Protein (NOSIP) Polyclonal Antibody (Human), Cy3

4-PAA330Hu01-Cy3
  • EUR 389.00
  • EUR 3893.00
  • EUR 1067.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOSIP (Gly62~Ser295)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Nitric Oxide Synthase Interacting Protein (NOSIP). This antibody is labeled with Cy3.

Nitric Oxide Synthase Interacting Protein (NOSIP) Polyclonal Antibody (Human), FITC

4-PAA330Hu01-FITC
  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOSIP (Gly62~Ser295)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Nitric Oxide Synthase Interacting Protein (NOSIP). This antibody is labeled with FITC.

Nitric Oxide Synthase Interacting Protein (NOSIP) Polyclonal Antibody (Human), HRP

4-PAA330Hu01-HRP
  • EUR 296.00
  • EUR 2574.00
  • EUR 737.00
  • EUR 369.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOSIP (Gly62~Ser295)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Nitric Oxide Synthase Interacting Protein (NOSIP). This antibody is labeled with HRP.

Nitric Oxide Synthase Interacting Protein (NOSIP) Polyclonal Antibody (Human), PE

4-PAA330Hu01-PE
  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOSIP (Gly62~Ser295)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Nitric Oxide Synthase Interacting Protein (NOSIP). This antibody is labeled with PE.

Nitric Oxide Synthase Interacting Protein (NOSIP) Polyclonal Antibody (Human), APC-Cy7

4-PAA330Hu01-APC-Cy7
  • EUR 526.00
  • EUR 5782.00
  • EUR 1543.00
  • EUR 695.00
  • EUR 299.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOSIP (Gly62~Ser295)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Nitric Oxide Synthase Interacting Protein (NOSIP). This antibody is labeled with APC-Cy7.

Nitric Oxide Synthase Interacting Protein (NOSIP) Antibody

20-abx104249
  • EUR 398.00
  • EUR 133.00
  • EUR 1094.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

NOSIP Rabbit Polyclonal Antibody