NR0B2 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

NR0B2 Polyclonal Antibody

ABP59520-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NR0B2 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of NR0B2 from Human, Mouse, Rat. This NR0B2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR0B2 protein at amino acid sequence of 30-110

NR0B2 Polyclonal Antibody

ABP59520-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NR0B2 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of NR0B2 from Human, Mouse, Rat. This NR0B2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR0B2 protein at amino acid sequence of 30-110

NR0B2 Polyclonal Antibody

A60066 100 µg
EUR 570.55
Description: kits suitable for this type of research

NR0B2 Rabbit pAb

A1836-100ul 100 ul
EUR 308

NR0B2 Rabbit pAb

A1836-200ul 200 ul
EUR 459

NR0B2 Rabbit pAb

A1836-20ul 20 ul
EUR 183

NR0B2 Rabbit pAb

A1836-50ul 50 ul
EUR 223

NR0B2 Rabbit pAb

A16454-100ul 100 ul
EUR 308

NR0B2 Rabbit pAb

A16454-200ul 200 ul
EUR 459

NR0B2 Rabbit pAb

A16454-20ul 20 ul
EUR 183

NR0B2 Rabbit pAb

A16454-50ul 50 ul
EUR 223

NR0B2 Antibody

ABD6648 100 ug
EUR 438

NR0B2 Antibody

32460-100ul 100ul
EUR 252

NR0B2 antibody

22509-100ul 100ul
EUR 390

NR0B2 antibody

70R-1927 50 ug
EUR 467
Description: Rabbit polyclonal NR0B2 antibody raised against the N terminal of NR0B2

NR0B2 antibody

70R-1928 50 ug
EUR 467
Description: Rabbit polyclonal NR0B2 antibody raised against the middle region of NR0B2

NR0B2 antibody

70R-13571 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal NR0B2 antibody

NR0B2 Antibody

DF6648 200ul
EUR 304
Description: NR0B2 Antibody detects endogenous levels of total NR0B2.

NR0B2 Antibody

1-CSB-PA624025LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR0B2. Recognizes NR0B2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

NR0B2 Polyclonal Antibody, Biotin Conjugated

A60067 100 µg
EUR 570.55
Description: fast delivery possible

NR0B2 Polyclonal Antibody, FITC Conjugated

A60068 100 µg
EUR 570.55
Description: reagents widely cited

NR0B2 Polyclonal Antibody, HRP Conjugated

A60069 100 µg
EUR 570.55
Description: Ask the seller for details

Nr0b2/ Rat Nr0b2 ELISA Kit

ELI-38189r 96 Tests
EUR 886

NR0B2 Conjugated Antibody

C32460 100ul
EUR 397

NR0B2 Antibody (HRP)

20-abx307126
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NR0B2 Antibody (FITC)

20-abx307127
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NR0B2 Antibody (Biotin)

20-abx307128
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-NR0B2 antibody

STJ24808 100 µl
EUR 277
Description: The protein encoded by this gene is an unusual orphan receptor that contains a putative ligand-binding domain but lacks a conventional DNA-binding domain. The gene product is a member of the nuclear hormone receptor family, a group of transcription factors regulated by small hydrophobic hormones, a subset of which do not have known ligands and are referred to as orphan nuclear receptors. The protein has been shown to interact with retinoid and thyroid hormone receptors, inhibiting their ligand-dependent transcriptional activation. In addition, interaction with estrogen receptors has been demonstrated, leading to inhibition of function. Studies suggest that the protein represses nuclear hormone receptor-mediated transactivation via two separate steps: competition with coactivators and the direct effects of its transcriptional repressor function.

Anti-NR0B2 antibody

STJ118894 100 µl
EUR 277

Anti-NR0B2 antibody

STJ191103 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NR0B2

NR0B2 siRNA

20-abx903639
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR0B2 siRNA

20-abx926315
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR0B2 siRNA

20-abx926316
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-NR0B2

YF-PA15626 50 ug
EUR 363
Description: Mouse polyclonal to NR0B2

anti-NR0B2

YF-PA25095 50 ul
EUR 334
Description: Mouse polyclonal to NR0B2

NR0B2 Antibody, HRP conjugated

1-CSB-PA624025LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR0B2. Recognizes NR0B2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NR0B2 Antibody, FITC conjugated

1-CSB-PA624025LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR0B2. Recognizes NR0B2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NR0B2 Antibody, Biotin conjugated

1-CSB-PA624025LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR0B2. Recognizes NR0B2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NR0B2 Blocking Peptide

33R-1113 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SYT12 antibody, catalog no. 70R-9795

NR0B2 Blocking Peptide

33R-8889 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR0B2 antibody, catalog no. 70R-1927

NR0B2 Blocking Peptide

DF6648-BP 1mg
EUR 195

NR0B2 cloning plasmid

CSB-CL624025HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 774
  • Sequence: atgagcaccagccaaccaggggcctgcccatgccagggagctgcaagccgccccgccattctctacgcacttctgagctccagcctcaaggctgtcccccgaccccgtagccgctgcctatgtaggcagcaccggcccgtccagctatgtgcacctcatcgcacctgccgggaggc
  • Show more
Description: A cloning plasmid for the NR0B2 gene.

Anti-NR0B2 (1A11)

YF-MA16353 100 ug
EUR 363
Description: Mouse monoclonal to NR0B2

Mouse NR0B2 shRNA Plasmid

20-abx973574
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NR0B2 shRNA Plasmid

20-abx987445
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Nr0b2 ELISA KIT

ELI-22254m 96 Tests
EUR 865

Human NR0B2 ELISA KIT

ELI-14852h 96 Tests
EUR 824

Human NR0B2 shRNA Plasmid

20-abx955522
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NR0B2 Recombinant Protein (Human)

RP021583 100 ug Ask for price

NR0B2 Recombinant Protein (Rat)

RP214427 100 ug Ask for price

pCMV-SPORT6-NR0B2 Plasmid

PVT16317 2 ug
EUR 325

NR0B2 Recombinant Protein (Mouse)

RP154838 100 ug Ask for price

Monoclonal NR0B2 Antibody (monoclonal) (M01), Clone: 1A11

APR17594G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NR0B2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1A11. This antibody is applicable in WB and IF, E

NR0B2 ORF Vector (Human) (pORF)

ORF007195 1.0 ug DNA
EUR 95

Nr0b2 ORF Vector (Rat) (pORF)

ORF071477 1.0 ug DNA
EUR 506

Nr0b2 ORF Vector (Mouse) (pORF)

ORF051614 1.0 ug DNA
EUR 506

NR0B2 ELISA Kit (Human) (OKCD00321)

OKCD00321 96 Wells
EUR 831
Description: Description of target: Acts as a transcriptional regulator. Acts as a negative regulator of receptor-dependent signaling pathways. Specifically inhibits transactivation of the nuclear receptor with whom it interacts. Inhibits transcriptional activity of NEUROD1 on E-box-containing promoter by interfering with the coactivation function of the p300/CBP-mediated trancription complex for NEUROD1.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.8"Orphan nuclear receptor small heterodimer partner, a novel corepressor for a basic helix-loop-helix transcription factor BETA2/neuroD."_x005F_x005F_x000D_Kim J.Y., Chu K., Kim H.J., Seong H.A., Park K.C., Sanyal S., Takeda J., Ha H., Shong M., Tsai M.J., Choi H.S._x005F_x005F_x000D_Mol. Endocrinol. 18:776-790(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, HETERODIMERIZATION, INTERACTION WITH ID2 AND NEUROD1, SUBCELLULAR LOCATION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.054 ng/mL

NR0B2 sgRNA CRISPR Lentivector set (Human)

K1454101 3 x 1.0 ug
EUR 339

Nr0b2 sgRNA CRISPR Lentivector set (Mouse)

K4360501 3 x 1.0 ug
EUR 339

Nr0b2 sgRNA CRISPR Lentivector set (Rat)

K7090401 3 x 1.0 ug
EUR 339

NR0B2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1454102 1.0 ug DNA
EUR 154

NR0B2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1454103 1.0 ug DNA
EUR 154

NR0B2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1454104 1.0 ug DNA
EUR 154

Nr0b2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4360502 1.0 ug DNA
EUR 154

Nr0b2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4360503 1.0 ug DNA
EUR 154

NR0B2 Rabbit Polyclonal Antibody