NR2C2 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

NR2C2 Polyclonal Antibody

ABP59525-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NR2C2 protein at amino acid sequence of 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of NR2C2 from Human, Mouse, Rat. This NR2C2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR2C2 protein at amino acid sequence of 410-490

NR2C2 Polyclonal Antibody

ABP59525-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NR2C2 protein at amino acid sequence of 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of NR2C2 from Human, Mouse, Rat. This NR2C2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR2C2 protein at amino acid sequence of 410-490

NR2C2 Rabbit pAb

A6422-100ul 100 ul
EUR 308

NR2C2 Rabbit pAb

A6422-200ul 200 ul
EUR 459

NR2C2 Rabbit pAb

A6422-20ul 20 ul
EUR 183

NR2C2 Rabbit pAb

A6422-50ul 50 ul
EUR 223

NR2C2 antibody

70R-5229 50 ug
EUR 467
Description: Rabbit polyclonal NR2C2 antibody raised against the N terminal of NR2C2

NR2C2 Antibody

ABD2219 100 ug
EUR 438

NR2C2 Antibody

ABD8175 100 ug
EUR 438

NR2C2 Antibody

ABD8255 100 ug
EUR 438

NR2C2 antibody

38900-100ul 100ul
EUR 252

NR2C2 antibody

20R-2872 100 ul
EUR 349
Description: Rabbit polyclonal NR2C2 antibody

NR2C2 antibody

70R-1547 100 ug
EUR 377
Description: Rabbit polyclonal NR2C2 antibody raised against the C terminal of NR2C2

NR2C2 Antibody

DF8175 200ul
EUR 304
Description: NR2C2 Antibody detects endogenous levels of total NR2C2.

NR2C2 Antibody

DF2219 200ul
EUR 304
Description: NR2C2 antibody detects endogenous levels of total NR2C2.

NR2C2 Antibody

1-CSB-PA016052ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NR2C2. Recognizes NR2C2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Nr2c2/ Rat Nr2c2 ELISA Kit

ELI-15026r 96 Tests
EUR 886

NR2C2 Conjugated Antibody

C38900 100ul
EUR 397

anti- NR2C2 antibody

FNab05841 100µg
EUR 585
  • Immunogen: nuclear receptor subfamily 2, group C, member 2
  • Uniprot ID: P49116
  • Gene ID: 7182
  • Research Area: Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against NR2C2

Anti-NR2C2 antibody

PAab05841 100 ug
EUR 412

Anti-NR2C2 antibody

STJ28505 100 µl
EUR 277
Description: This gene encodes a protein that belongs to the nuclear hormone receptor family. Members of this family act as ligand-activated transcription factors and function in many biological processes such as development, cellular differentiation and homeostasis. The activated receptor/ligand complex is translocated to the nucleus where it binds to hormone response elements of target genes. The protein encoded by this gene plays a role in protecting cells from oxidative stress and damage induced by ionizing radiation. The lack of a similar gene in mouse results in growth retardation, severe spinal curvature, subfertility, premature aging, and prostatic intraepithelial neoplasia (PIN) development. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-NR2C2 antibody

STJ191123 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NR2C2

NR2C2 siRNA

20-abx903647
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR2C2 siRNA

20-abx926335
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR2C2 siRNA

20-abx926336
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-NR2C2

YF-PA15110 50 ul
EUR 363
Description: Mouse polyclonal to NR2C2

anti-NR2C2

YF-PA15111 100 ug
EUR 403
Description: Rabbit polyclonal to NR2C2

anti-NR2C2

YF-PA24892 50 ul
EUR 334
Description: Mouse polyclonal to NR2C2

NR2C2 cloning plasmid

CSB-CL016052HU-10ug 10ug
EUR 556
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1593
  • Sequence: atgaccagcccctccccacgcatccagataatctccaccgactctgctgtagcctcacctcagcgcattcagggctctgaacctgcctctggcccattgagtgttttcacatctttgaacaaagagaagattgtcacagaccagcagacaggacagaaaatccagatagtcaccg
  • Show more
Description: A cloning plasmid for the NR2C2 gene.

NR2C2 Blocking Peptide

33R-4073 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR2C2 antibody, catalog no. 70R-5229

NR2C2 Blocking Peptide

33R-1445 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR2C2 antibody, catalog no. 70R-1547

NR2C2 Blocking Peptide

DF8175-BP 1mg
EUR 195

NR2C2 Blocking Peptide

DF2219-BP 1mg
EUR 195

pET32a-NR2C2 Plasmid

PVT14773 2 ug
EUR 370

Anti-NR2C2 (2A5)

YF-MA10970 100 ug
EUR 363
Description: Mouse monoclonal to NR2C2

Rat NR2C2 shRNA Plasmid

20-abx985745
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NR2C2 ELISA Kit

ELA-E10644h 96 Tests
EUR 824

Mouse Nr2c2 ELISA KIT

ELI-21288m 96 Tests
EUR 865

NR2C2 ELISA KIT|Human

EF001317 96 Tests
EUR 689

Human NR2C2 ELISA KIT

ELI-36908h 96 Tests
EUR 824

Human NR2C2 shRNA Plasmid

20-abx954932
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NR2C2 shRNA Plasmid

20-abx973203
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NR2C2 Recombinant Protein (Human)

RP021607 100 ug Ask for price

NR2C2 Recombinant Protein (Rat)

RP214457 100 ug Ask for price

NR2C2 Recombinant Protein (Mouse)

RP154892 100 ug Ask for price

NR2C2 ORF Vector (Human) (pORF)

ORF007203 1.0 ug DNA
EUR 95

Nr2c2 ORF Vector (Rat) (pORF)

ORF071487 1.0 ug DNA
EUR 506

Nr2c2 ORF Vector (Mouse) (pORF)

ORF051632 1.0 ug DNA
EUR 506

NR2C2 ELISA Kit (Human) (OKEH07633)

OKEH07633 96 Wells
EUR 896
Description: Description of target: This gene encodes a protein that belongs to the nuclear hormone receptor family. Members of this family act as ligand-activated transcription factors and function in many biological processes such as development, cellular differentiation and homeostasis. The activated receptor/ligand complex is translocated to the nucleus where it binds to hormone response elements of target genes. The protein encoded by this gene plays a role in protecting cells from oxidative stress and damage induced by ionizing radiation. The lack of a similar gene in mouse results in growth retardation, severe spinal curvature, subfertility, premature aging, and prostatic intraepithelial neoplasia (PIN) development. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.081ng/mL

NR2C2 sgRNA CRISPR Lentivector set (Human)

K1452201 3 x 1.0 ug
EUR 339

Nr2c2 sgRNA CRISPR Lentivector set (Mouse)

K4452001 3 x 1.0 ug
EUR 339

Nr2c2 sgRNA CRISPR Lentivector set (Rat)

K6870201 3 x 1.0 ug
EUR 339

NR2C2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1452202 1.0 ug DNA
EUR 154

NR2C2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1452203 1.0 ug DNA
EUR 154

NR2C2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1452204 1.0 ug DNA
EUR 154

Nr2c2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4452002 1.0 ug DNA
EUR 154

Nr2c2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4452003 1.0 ug DNA
EUR 154

Nr2c2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4452004 1.0 ug DNA
EUR 154

Nr2c2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6870202 1.0 ug DNA
EUR 154

Nr2c2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6870203 1.0 ug DNA
EUR 154

Nr2c2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6870204 1.0 ug DNA
EUR 154

Recombinant Human NR2C2 Protein, His, E.coli-100ug

QP8855-ec-100ug 100ug
EUR 408

Recombinant Human NR2C2 Protein, His, E.coli-10ug

QP8855-ec-10ug 10ug
EUR 200

Recombinant Human NR2C2 Protein, His, E.coli-1mg

QP8855-ec-1mg 1mg
EUR 1632

Recombinant Human NR2C2 Protein, His, E.coli-200ug

QP8855-ec-200ug 200ug
EUR 634

Recombinant Human NR2C2 Protein, His, E.coli-500ug

QP8855-ec-500ug 500ug
EUR 1060

Recombinant Human NR2C2 Protein, His, E.coli-50ug

QP8855-ec-50ug 50ug
EUR 263

NR2C2 Protein Vector (Human) (pPB-C-His)

PV028809 500 ng
EUR 329

NR2C2 Protein Vector (Human) (pPB-N-His)

PV028810 500 ng
EUR 329

NR2C2 Protein Vector (Human) (pPM-C-HA)

PV028811 500 ng
EUR 329

NR2C2 Protein Vector (Human) (pPM-C-His)

PV028812 500 ng
EUR 329

NR2C2 Protein Vector (Mouse) (pPB-C-His)

PV206526 500 ng
EUR 603

NR2C2 Protein Vector (Mouse) (pPB-N-His)

PV206527 500 ng
EUR 603

NR2C2 Protein Vector (Mouse) (pPM-C-HA)

PV206528 500 ng
EUR 603

NR2C2 Protein Vector (Mouse) (pPM-C-His)

PV206529 500 ng
EUR 603

NR2C2 Protein Vector (Rat) (pPB-C-His)

PV285946 500 ng
EUR 603

NR2C2 Protein Vector (Rat) (pPB-N-His)

PV285947 500 ng
EUR 603

NR2C2 Protein Vector (Rat) (pPM-C-HA)

PV285948 500 ng
EUR 603

NR2C2 Protein Vector (Rat) (pPM-C-His)

PV285949 500 ng
EUR 603

Nr2c2 3'UTR GFP Stable Cell Line

TU164294 1.0 ml Ask for price

NR2C2 3'UTR Luciferase Stable Cell Line

TU015940 1.0 ml
EUR 4617

Nr2c2 3'UTR Luciferase Stable Cell Line

TU114294 1.0 ml Ask for price

NR2C2 3'UTR GFP Stable Cell Line

TU065940 1.0 ml
EUR 4617

Nr2c2 3'UTR GFP Stable Cell Line

TU264164 1.0 ml Ask for price

Nr2c2 3'UTR Luciferase Stable Cell Line

TU214164 1.0 ml Ask for price

NR2C2 Rabbit Polyclonal Antibody