OAZ3 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

OAZ3 Polyclonal Antibody

ABP59634-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human OAZ3 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of OAZ3 from Human. This OAZ3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OAZ3 protein at amino acid sequence of 90-170

OAZ3 Polyclonal Antibody

ABP59634-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human OAZ3 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of OAZ3 from Human. This OAZ3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OAZ3 protein at amino acid sequence of 90-170

OAZ3 Polyclonal Antibody

ES9964-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against OAZ3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

OAZ3 Polyclonal Antibody

ES9964-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against OAZ3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

OAZ3 Antibody

46115-100ul 100ul
EUR 252

OAZ3 Antibody

46115-50ul 50ul
EUR 187

OAZ3 Antibody

DF9726 200ul
EUR 304
Description: OAZ3 Antibody detects endogenous levels of total OAZ3.

OAZ3 Antibody

1-CSB-PA016247LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OAZ3. Recognizes OAZ3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

OAZ3 antibody

70R-50999 100 ul
EUR 244
Description: Purified Polyclonal OAZ3 antibody

OAZ3 antibody

70R-9243 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal OAZ3 antibody

OAZ3 Antibody

ABD9726 100 ug
EUR 438

OAZ3 Polyclonal Antibody, HRP Conjugated

A63071 100 µg
EUR 570.55
Description: kits suitable for this type of research

OAZ3 Polyclonal Antibody, FITC Conjugated

A63072 100 µg
EUR 570.55
Description: fast delivery possible

OAZ3 Polyclonal Antibody, Biotin Conjugated

A63073 100 µg
EUR 570.55
Description: reagents widely cited

OAZ3 Conjugated Antibody

C46115 100ul
EUR 397

Anti-OAZ3 antibody

STJ191122 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to OAZ3

OAZ3 siRNA

20-abx926740
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OAZ3 siRNA

20-abx926741
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-OAZ3

YF-PA19164 50 ul
EUR 363
Description: Mouse polyclonal to OAZ3

OAZ3 Antibody, HRP conjugated

1-CSB-PA016247LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OAZ3. Recognizes OAZ3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

OAZ3 Antibody, FITC conjugated

1-CSB-PA016247LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OAZ3. Recognizes OAZ3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

OAZ3 Antibody, Biotin conjugated

1-CSB-PA016247LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OAZ3. Recognizes OAZ3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

OAZ3 Blocking Peptide

33R-2147 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OAZ3 antibody, catalog no. 70R-9243

OAZ3 Blocking Peptide

DF9726-BP 1mg
EUR 195

OAZ3 Blocking Peptide

20-abx063874
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

OAZ3 cloning plasmid

CSB-CL016247HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 573
  • Sequence: atgaccgtgccctggcggccaggaaagcgacgcatcacttataaggaagaggaggacttgacactccagccccgtcctgcctccagtgctcctgagtccctagtaggcctccaggagggcaaaagcaccgagcagggtaaccacgaccagcttaaagaactgtattcggctgggaa
  • Show more
Description: A cloning plasmid for the OAZ3 gene.

Mouse OAZ3 shRNA Plasmid

20-abx974374
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human OAZ3 shRNA Plasmid

20-abx959899
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

OAZ3 Recombinant Protein (Human)

RP022018 100 ug Ask for price

OAZ3 Recombinant Protein (Mouse)

RP155663 100 ug Ask for price

OAZ3 Recombinant Protein (Rat)

RP214991 100 ug Ask for price

Ornithine Decarboxylase Antizyme 3 (OAZ3) Antibody

20-abx008139
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ornithine Decarboxylase Antizyme 3 (OAZ3) Antibody

20-abx217321
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ornithine Decarboxylase Antizyme 3 (OAZ3) Antibody

20-abx304695
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ornithine Decarboxylase Antizyme 3 (OAZ3) Antibody (HRP)

20-abx304696
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ornithine Decarboxylase Antizyme 3 (OAZ3) Antibody (FITC)

20-abx304697
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ornithine Decarboxylase Antizyme 3 (OAZ3) Antibody (Biotin)

20-abx304698
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Oaz3 ORF Vector (Rat) (pORF)

ORF071665 1.0 ug DNA
EUR 506

OAZ3 ORF Vector (Human) (pORF)

ORF007340 1.0 ug DNA
EUR 95

Oaz3 ORF Vector (Mouse) (pORF)

ORF051889 1.0 ug DNA
EUR 506

Oaz3 sgRNA CRISPR Lentivector set (Rat)

K7515301 3 x 1.0 ug
EUR 339

Oaz3 sgRNA CRISPR Lentivector set (Mouse)

K3933501 3 x 1.0 ug
EUR 339

OAZ3 sgRNA CRISPR Lentivector set (Human)

K1473801 3 x 1.0 ug
EUR 339

Oaz3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7515302 1.0 ug DNA
EUR 154

Oaz3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7515303 1.0 ug DNA
EUR 154

Oaz3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7515304 1.0 ug DNA
EUR 154

Oaz3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3933502 1.0 ug DNA
EUR 154

Oaz3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3933503 1.0 ug DNA
EUR 154

Oaz3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3933504 1.0 ug DNA
EUR 154

OAZ3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1473802 1.0 ug DNA
EUR 154

OAZ3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1473803 1.0 ug DNA
EUR 154

OAZ3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1473804 1.0 ug DNA
EUR 154

OAZ3 Protein Vector (Rat) (pPB-C-His)

PV286658 500 ng
EUR 603

OAZ3 Protein Vector (Rat) (pPB-N-His)

PV286659 500 ng
EUR 603

OAZ3 Protein Vector (Rat) (pPM-C-HA)

PV286660 500 ng
EUR 603

OAZ3 Protein Vector (Rat) (pPM-C-His)

PV286661 500 ng
EUR 603

OAZ3 Protein Vector (Mouse) (pPB-C-His)

PV207554 500 ng
EUR 603

OAZ3 Protein Vector (Mouse) (pPB-N-His)

PV207555 500 ng
EUR 603

OAZ3 Protein Vector (Mouse) (pPM-C-HA)

PV207556 500 ng
EUR 603

OAZ3 Protein Vector (Mouse) (pPM-C-His)

PV207557 500 ng
EUR 603

OAZ3 Protein Vector (Human) (pPB-C-His)

PV029357 500 ng
EUR 329

OAZ3 Protein Vector (Human) (pPB-N-His)

PV029358 500 ng
EUR 329

OAZ3 Protein Vector (Human) (pPM-C-HA)

PV029359 500 ng
EUR 329

OAZ3 Protein Vector (Human) (pPM-C-His)

PV029360 500 ng
EUR 329

Oaz3 3'UTR Luciferase Stable Cell Line

TU114490 1.0 ml Ask for price

Oaz3 3'UTR GFP Stable Cell Line

TU164490 1.0 ml Ask for price

Oaz3 3'UTR Luciferase Stable Cell Line

TU214348 1.0 ml Ask for price

Oaz3 3'UTR GFP Stable Cell Line

TU264348 1.0 ml Ask for price

OAZ3 3'UTR GFP Stable Cell Line

TU066164 1.0 ml
EUR 1394

OAZ3 3'UTR Luciferase Stable Cell Line

TU016164 1.0 ml
EUR 1394

Mouse Ornithine decarboxylase antizyme 3, Oaz3 ELISA KIT

ELI-21393m 96 Tests
EUR 865

Human Ornithine decarboxylase antizyme 3, OAZ3 ELISA KIT

ELI-46337h 96 Tests
EUR 824

OAZ3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV641377 1.0 ug DNA
EUR 514

OAZ3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV641381 1.0 ug DNA
EUR 514

OAZ3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV641382 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

OAZ3 Rabbit Polyclonal Antibody