OVOL2 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

OVOL2 Polyclonal Antibody
ABP59778-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human OVOL2 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of OVOL2 from Human, Mouse. This OVOL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OVOL2 protein at amino acid sequence of 90-170

OVOL2 Rabbit pAb
A17973-100ul 100 ul
EUR 308

OVOL2 Rabbit pAb
A17973-200ul 200 ul
EUR 459

OVOL2 Rabbit pAb
A17973-20ul 20 ul
EUR 183

OVOL2 Rabbit pAb
A17973-50ul 50 ul
EUR 223

OVOL2 Antibody
47724-100ul 100ul
EUR 252

OVOL2 Antibody
1-CSB-PA887110HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OVOL2. Recognizes OVOL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal OVOL2 antibody - middle region
APR00624G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OVOL2 - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal OVOL2 antibody - middle region
APR00760G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OVOL2 - middle region. This antibody is tested and proven to work in the following applications:

OVOL2 Conjugated Antibody
C47724 100ul
EUR 397

OVOL2 Antibody (HRP)
20-abx313973
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

OVOL2 Antibody (FITC)
20-abx313974
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

OVOL2 Antibody (Biotin)
20-abx313975
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-OVOL2 antibody
STJ119952 100 µl
EUR 277

Anti-OVOL2 antibody
STJ191535 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to OVOL2

OVOL2 siRNA
20-abx927494
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OVOL2 siRNA
20-abx927495
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-OVOL2
YF-PA20324 50 ul
EUR 363
Description: Mouse polyclonal to OVOL2

anti-OVOL2
YF-PA20325 50 ug
EUR 363
Description: Mouse polyclonal to OVOL2

anti-OVOL2
YF-PA20327 50 ug
EUR 363
Description: Mouse polyclonal to OVOL2

OVOL2 Antibody, HRP conjugated
1-CSB-PA887110HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OVOL2. Recognizes OVOL2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

OVOL2 Antibody, FITC conjugated
1-CSB-PA887110HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OVOL2. Recognizes OVOL2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

OVOL2 Antibody, Biotin conjugated
1-CSB-PA887110HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OVOL2. Recognizes OVOL2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

OVOL2 cloning plasmid
CSB-CL887110HU-10ug 10ug
EUR 342
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 828
  • Sequence: atgcccaaagtcttcctggtgaagaggaggagcctgggggtctcggtccgcagctgggatgagctcccggatgagaaaagggcagacacctacatcccagtgggcctaggccgcctgctccacgacccccccgaggactgccgcagcgacggcggcagcagcagcggcagcggcag
  • Show more
Description: A cloning plasmid for the OVOL2 gene.

Mouse OVOL2 shRNA Plasmid
20-abx979818
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human OVOL2 shRNA Plasmid
20-abx961724
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

OVOL2 Recombinant Protein (Human)
RP022309 100 ug Ask for price

OVOL2 Recombinant Protein (Rat)
RP219002 100 ug Ask for price

OVOL2 Recombinant Protein (Mouse)
RP159692 100 ug Ask for price

OVOL2 Rabbit Polyclonal Antibody