P2RX1 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

P2RX1 Polyclonal Antibody
ABP59785-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human P2RX1 protein at amino acid sequence of 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of P2RX1 from Human, Mouse, Rat. This P2RX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human P2RX1 protein at amino acid sequence of 150-230
P2RX1 Polyclonal Antibody
ABP59785-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human P2RX1 protein at amino acid sequence of 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of P2RX1 from Human, Mouse, Rat. This P2RX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human P2RX1 protein at amino acid sequence of 150-230
P2RX1 Polyclonal Antibody
ES9967-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against P2RX1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
P2RX1 Polyclonal Antibody
ES9967-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against P2RX1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
P2RX1 Rabbit pAb
A11817-100ul 100 ul
EUR 308
P2RX1 Rabbit pAb
A11817-200ul 200 ul
EUR 459
P2RX1 Rabbit pAb
A11817-20ul 20 ul Ask for price
P2RX1 Rabbit pAb
A11817-50ul 50 ul Ask for price
P2RX1 Rabbit pAb
A7914-100ul 100 ul
EUR 308
P2RX1 Rabbit pAb
A7914-200ul 200 ul
EUR 459
P2RX1 Rabbit pAb
A7914-20ul 20 ul
EUR 183
P2RX1 Rabbit pAb
A7914-50ul 50 ul
EUR 223
P2RX1 antibody
70R-1546 100 ug
EUR 377
Description: Rabbit polyclonal P2RX1 antibody raised against the middle region of P2RX1
P2RX1 Antibody
46117-100ul 100ul
EUR 252
P2RX1 Antibody
46117-50ul 50ul
EUR 187
P2RX1 Antibody
DF9728 200ul
EUR 304
Description: P2RX1 Antibody detects endogenous levels of total P2RX1.
P2RX1 Antibody
1-CSB-PA017319LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX1. Recognizes P2RX1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:5000, IHC:1:20-1:200, IF:1:50-1:200
P2RX1 Antibody
ABD9728 100 ug
EUR 438
Polyclonal P2RX1 Antibody (C-term)
APR12644G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RX1 (C-term). This antibody is tested and proven to work in the following applications:
P2RX1 Conjugated Antibody
C46117 100ul
EUR 397
Anti-P2RX1 antibody
STJ110223 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the P2X family of G-protein-coupled receptors. These proteins can form homo-and heterotimers and function as ATP-gated ion channels and mediate rapid and selective permeability to cations. This protein is primarily localized to smooth muscle where binds ATP and mediates synaptic transmission between neurons and from neurons to smooth muscle and may being responsible for sympathetic vasoconstriction in small arteries, arterioles and vas deferens. Mouse studies suggest that this receptor is essential for normal male reproductive function. This protein may also be involved in promoting apoptosis.
Anti-P2RX1 antibody
STJ113396 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the P2X family of G-protein-coupled receptors. These proteins can form homo-and heterotimers and function as ATP-gated ion channels and mediate rapid and selective permeability to cations. This protein is primarily localized to smooth muscle where binds ATP and mediates synaptic transmission between neurons and from neurons to smooth muscle and may being responsible for sympathetic vasoconstriction in small arteries, arterioles and vas deferens. Mouse studies suggest that this receptor is essential for normal male reproductive function. This protein may also be involved in promoting apoptosis.
Anti-P2RX1 antibody
STJ191125 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to P2RX1
P2rx1/ Rat P2rx1 ELISA Kit
ELI-44307r 96 Tests
EUR 886
P2RX1 siRNA
20-abx903797
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
P2RX1 siRNA
20-abx927524
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
P2RX1 siRNA
20-abx927525
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
P2RX1 Antibody, HRP conjugated
1-CSB-PA017319LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX1. Recognizes P2RX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
P2RX1 Antibody, FITC conjugated
1-CSB-PA017319LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX1. Recognizes P2RX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
P2RX1 Antibody, Biotin conjugated
1-CSB-PA017319LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX1. Recognizes P2RX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
P2RX1 Blocking Peptide
33R-9880 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX1 antibody, catalog no. 70R-1546
P2RX1 Blocking Peptide
DF9728-BP 1mg
EUR 195
P2RX1 cloning plasmid
CSB-CL017319HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1200
  • Sequence: atggcacggcggttccaggaggagctggccgccttcctcttcgagtatgacaccccccgcatggtgctggtgcgtaataagaaggtgggcgttatcttccgactgatccagctggtggtcctggtctacgtcatcgggtgggtgtttctctatgagaagggctaccagacctcga
  • Show more
Description: A cloning plasmid for the P2RX1 gene.
P2RX1 cloning plasmid
CSB-CL017319HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 528
  • Sequence: atggcacggcggttccaggaggagctggccgccttcctcttcgagtatgacaccccccgcatggtgctggtgcgtaataagaaggtgggcgttatcttccgactgatccagctggtggtcctggtctacgtcatcgggtgggtgtttctctatgagaagggctaccagacctcgag
  • Show more
Description: A cloning plasmid for the P2RX1 gene.
P2RX1 ELISA KIT|Human
EF007400 96 Tests
EUR 689
Mouse P2RX1 shRNA Plasmid
20-abx971906
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat P2RX1 shRNA Plasmid
20-abx985076
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human P2RX1 shRNA Plasmid
20-abx953336
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
P2RX1 Recombinant Protein (Human)
RP022336 100 ug Ask for price
P2RX1 Recombinant Protein (Human)
RP022339 100 ug Ask for price
P2RX1 Recombinant Protein (Mouse)
RP159743 100 ug Ask for price
P2RX1 Recombinant Protein (Rat)
RP219044 100 ug Ask for price
P2RX1 Recombinant Protein (Rat)
RP219047 100 ug Ask for price
Purinergic Receptor P2X 1 (P2RX1) Antibody
20-abx005663
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Purinergic Receptor P2X 1 (P2RX1) Antibody
20-abx217583
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Purinergic Receptor P2X 1 (P2RX1) Antibody
20-abx126991
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Purinergic Receptor P2X 1 (P2RX1) Antibody
abx029072-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Purinergic Receptor P2X 1 (P2RX1) Antibody
abx029072-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Purinergic Receptor P2X 1 (P2RX1) Antibody
20-abx302267
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Purinergic Receptor P2X 1 (P2RX1) Antibody (HRP)
20-abx315898
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Purinergic Receptor P2X 1 (P2RX1) Antibody (FITC)
20-abx315899
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Purinergic Receptor P2X 1 (P2RX1) Antibody (Biotin)
20-abx315900
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
P2rx1 ORF Vector (Rat) (pORF)
ORF073016 1.0 ug DNA
EUR 506
P2rx1 ORF Vector (Rat) (pORF)
ORF073017 1.0 ug DNA
EUR 506
P2RX1 ORF Vector (Human) (pORF)
ORF007446 1.0 ug DNA
EUR 95
P2RX1 ORF Vector (Human) (pORF)
ORF007447 1.0 ug DNA
EUR 95
P2rx1 ORF Vector (Mouse) (pORF)
ORF053249 1.0 ug DNA
EUR 506
P2RX1 ELISA Kit (Human) (OKCA00747)
OKCA00747 96 Wells
EUR 833
Description: Description of target: Ligand-gated ion channel with relatively high calcium permeability. Binding to ATP mediates synaptic transmission between neurons and from neurons to smooth muscle. Seems to be linked to apoptosis, by increasing the intracellular concentration of calcium in the presence of ATP, leading to programmed cell death.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL
P2rx1 sgRNA CRISPR Lentivector set (Rat)
K6826701 3 x 1.0 ug
EUR 339
P2rx1 sgRNA CRISPR Lentivector set (Mouse)
K3656101 3 x 1.0 ug
EUR 339
P2RX1 sgRNA CRISPR Lentivector set (Human)
K1581201 3 x 1.0 ug
EUR 339
Human P2RX1(P2X purinoceptor 1) ELISA Kit
EH4227 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P51575
  • Alias: P2X1/ATP receptor|P2X purinoceptor 1|P2X receptor/subunit 1|P2X1 receptor|purinergic receptor P2X1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Mouse P2X purinoceptor 1, P2rx1 ELISA KIT
ELI-14696m 96 Tests
EUR 865
Human P2X purinoceptor 1, P2RX1 ELISA KIT
ELI-44306h 96 Tests
EUR 824
P2rx1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6826702 1.0 ug DNA
EUR 154
P2rx1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6826703 1.0 ug DNA
EUR 154
P2rx1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6826704 1.0 ug DNA
EUR 154
P2rx1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3656102 1.0 ug DNA
EUR 154
P2rx1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3656103 1.0 ug DNA
EUR 154
P2rx1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3656104 1.0 ug DNA
EUR 154
P2RX1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1581202 1.0 ug DNA
EUR 154
P2RX1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1581203 1.0 ug DNA
EUR 154
P2RX1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1581204 1.0 ug DNA
EUR 154
P2RX1 Protein Vector (Rat) (pPB-C-His)
PV292062 500 ng
EUR 603
P2RX1 Protein Vector (Rat) (pPB-N-His)
PV292063 500 ng
EUR 603
P2RX1 Protein Vector (Rat) (pPM-C-HA)
PV292064 500 ng
EUR 603
P2RX1 Protein Vector (Rat) (pPM-C-His)
PV292065 500 ng
EUR 603
P2RX1 Protein Vector (Rat) (pPB-C-His)
PV292066 500 ng
EUR 603
P2RX1 Protein Vector (Rat) (pPB-N-His)
PV292067 500 ng
EUR 603
P2RX1 Protein Vector (Rat) (pPM-C-HA)
PV292068 500 ng
EUR 603
P2RX1 Protein Vector (Rat) (pPM-C-His)
PV292069 500 ng
EUR 603
P2RX1 Protein Vector (Mouse) (pPB-C-His)
PV212994 500 ng
EUR 603
P2RX1 Protein Vector (Mouse) (pPB-N-His)
PV212995 500 ng
EUR 603
P2RX1 Protein Vector (Mouse) (pPM-C-HA)
PV212996 500 ng
EUR 603
P2RX1 Protein Vector (Mouse) (pPM-C-His)
PV212997 500 ng
EUR 603
P2RX1 Protein Vector (Human) (pPB-C-His)
PV029781 500 ng
EUR 329
P2RX1 Protein Vector (Human) (pPB-N-His)
PV029782 500 ng
EUR 329

P2RX1 Rabbit Polyclonal Antibody