P2RX4 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

P2RX4 Polyclonal Antibody

ABP59787-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human P2RX4 protein at amino acid sequence of 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of P2RX4 from Human, Mouse, Rat. This P2RX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human P2RX4 protein at amino acid sequence of 150-230

P2RX4 Polyclonal Antibody

ES9968-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against P2RX4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

P2RX4 Polyclonal Antibody

ES9968-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against P2RX4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

P2RX4 Rabbit pAb

A6682-100ul 100 ul
EUR 308

P2RX4 Rabbit pAb

A6682-200ul 200 ul
EUR 459

P2RX4 Rabbit pAb

A6682-20ul 20 ul
EUR 183

P2RX4 Rabbit pAb

A6682-50ul 50 ul
EUR 223

P2RX4 antibody

70R-19076 50 ul
EUR 435
Description: Rabbit polyclonal P2RX4 antibody

P2RX4 antibody

39096-100ul 100ul
EUR 252

P2RX4 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX4. Recognizes P2RX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

P2RX4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against P2RX4. Recognizes P2RX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

P2RX4 antibody

70R-5172 50 ug
EUR 467
Description: Rabbit polyclonal P2RX4 antibody raised against the N terminal of P2RX4

P2RX4 antibody

PAab10076 100 ug
EUR 386

Polyclonal P2RX4 / P2X4 Antibody (Internal)

APR12646G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human P2RX4 / P2X4 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal P2rx4 (mouse) Antibody (internal region)

APR12645G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human P2rx4 (mouse) (internal region). This antibody is tested and proven to work in the following applications:

P2rx4/ Rat P2rx4 ELISA Kit

ELI-12419r 96 Tests
EUR 886

P2RX4 Conjugated Antibody

C39096 100ul
EUR 397

anti- P2RX4 antibody

FNab06069 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: purinergic receptor P2X, ligand-gated ion channel, 4
  • Uniprot ID: Q99571
  • Gene ID: 5026
  • Research Area: Neuroscience, Cardiovascular, Signal Transductio
  • Show more
Description: Antibody raised against P2RX4

anti- P2RX4 antibody

FNab10076 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: purinergic receptor P2X, ligand-gated ion channel, 4
  • Uniprot ID: Q99571
  • Gene ID: 5026
  • Research Area: Neuroscience, Cardiovascular, Signal Transduction
Description: Antibody raised against P2RX4

Anti-P2RX4 Antibody

PA2127 100ug/vial
EUR 294

Anti-P2RX4 antibody

PAab06069 100 ug
EUR 355

Anti-P2RX4 Antibody

PB9304 100ug/vial
EUR 294

Anti-P2RX4 antibody

STJ28765 100 µl
EUR 277
Description: The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel with high calcium permeability. The main pharmacological distinction between the members of the purinoceptor family is the relative sensitivity to the antagonists suramin and PPADS. The product of this gene has the lowest sensitivity for these antagonists. Multiple alternatively spliced transcript variants, some protein-coding and some not protein-coding, have been found for this gene.

Anti-P2RX4 antibody

STJ191126 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to P2RX4


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA13571 50 ul
EUR 363
Description: Mouse polyclonal to P2RX4


YF-PA13572 50 ug
EUR 363
Description: Mouse polyclonal to P2RX4


YF-PA13573 100 ug
EUR 403
Description: Rabbit polyclonal to P2RX4

P2RX4 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX4. Recognizes P2RX4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

P2RX4 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX4. Recognizes P2RX4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

P2RX4 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX4. Recognizes P2RX4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-P2rx4 (mouse) antibody

STJ72755 100 µg
EUR 359

P2RX4 Blocking Peptide

33R-9751 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX4 antibody, catalog no. 70R-5172

P2RX4 cloning plasmid

CSB-CL859513HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1167
  • Sequence: atggcgggctgctgcgccgcgctggcggccttcctgttcgagtacgacacgccgcgcatcgtgctcatccgcagccgcaaagtggggctcatgaaccgcgccgtgcaactgctcatcctggcctacgtcatcgggtgggtgtttgtgtgggaaaagggctaccaggaaactgact
  • Show more
Description: A cloning plasmid for the P2RX4 gene.


EF001496 96 Tests
EUR 689

Rat P2RX4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human P2RX4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

P2RX4 Recombinant Protein (Human)

RP022342 100 ug Ask for price

P2RX4 Recombinant Protein (Mouse)

RP159758 100 ug Ask for price

P2RX4 Recombinant Protein (Rat)

RP219056 100 ug Ask for price

Purinergic Receptor P2X 4 (P2RX4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Purinergic Receptor P2X 4 (P2RX4) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Purinergic Receptor P2X 4 (P2RX4) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Purinergic Receptor P2X 4 (P2RX4) Antibody

abx236069-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Purinergic Receptor P2X 4 (P2rx4) Antibody

abx431482-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Purinergic Receptor P2X 4 (P2RX4) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Purinergic Receptor P2X 4 (P2RX4) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Purinergic Receptor P2X 4 (P2RX4) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse P2X purinoceptor 4 (P2rx4)

  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 47.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse P2X purinoceptor 4(P2rx4),partial expressed in in vitro E.coli expression system

P2rx4 ORF Vector (Rat) (pORF)

ORF073020 1.0 ug DNA
EUR 506

P2RX4 ORF Vector (Human) (pORF)

ORF007448 1.0 ug DNA
EUR 95

P2rx4 ORF Vector (Mouse) (pORF)

ORF053254 1.0 ug DNA
EUR 506

P2rx4 sgRNA CRISPR Lentivector set (Rat)

K6833801 3 x 1.0 ug
EUR 339

P2rx4 sgRNA CRISPR Lentivector set (Mouse)

K3911801 3 x 1.0 ug
EUR 339

P2RX4 sgRNA CRISPR Lentivector set (Human)

K1581501 3 x 1.0 ug
EUR 339

Mouse P2X purinoceptor 4, P2rx4 ELISA KIT

ELI-14549m 96 Tests
EUR 865

Bovine P2X purinoceptor 4, P2RX4 ELISA KIT

ELI-23282b 96 Tests
EUR 928

Human P2X purinoceptor 4, P2RX4 ELISA KIT

ELI-35726h 96 Tests
EUR 824

P2rx4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6833802 1.0 ug DNA
EUR 154

P2rx4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6833803 1.0 ug DNA
EUR 154

P2rx4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6833804 1.0 ug DNA
EUR 154

P2rx4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3911802 1.0 ug DNA
EUR 154

P2rx4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3911803 1.0 ug DNA
EUR 154

P2rx4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3911804 1.0 ug DNA
EUR 154

P2RX4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1581502 1.0 ug DNA
EUR 154

P2RX4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1581503 1.0 ug DNA
EUR 154

P2RX4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1581504 1.0 ug DNA
EUR 154

P2RX4 Protein Vector (Rat) (pPB-C-His)

PV292078 500 ng
EUR 603

P2RX4 Protein Vector (Rat) (pPB-N-His)

PV292079 500 ng
EUR 603

P2RX4 Protein Vector (Rat) (pPM-C-HA)

PV292080 500 ng
EUR 603

P2RX4 Protein Vector (Rat) (pPM-C-His)

PV292081 500 ng
EUR 603

P2RX4 Protein Vector (Mouse) (pPB-C-His)

PV213014 500 ng
EUR 603

P2RX4 Protein Vector (Mouse) (pPB-N-His)

PV213015 500 ng
EUR 603

P2RX4 Protein Vector (Mouse) (pPM-C-HA)

PV213016 500 ng
EUR 603

P2RX4 Protein Vector (Mouse) (pPM-C-His)

PV213017 500 ng
EUR 603

P2RX4 Protein Vector (Human) (pPB-C-His)

PV029789 500 ng
EUR 329

P2RX4 Protein Vector (Human) (pPB-N-His)

PV029790 500 ng
EUR 329

P2RX4 Protein Vector (Human) (pPM-C-HA)

PV029791 500 ng
EUR 329

P2RX4 Protein Vector (Human) (pPM-C-His)

PV029792 500 ng
EUR 329

P2rx4 3'UTR Luciferase Stable Cell Line

TU115809 1.0 ml Ask for price

P2rx4 3'UTR GFP Stable Cell Line

TU165809 1.0 ml Ask for price

P2rx4 3'UTR GFP Stable Cell Line

TU265724 1.0 ml Ask for price

P2rx4 3'UTR Luciferase Stable Cell Line

TU215724 1.0 ml Ask for price

P2RX4 3'UTR GFP Stable Cell Line

TU067249 1.0 ml
EUR 1394

P2RX4 3'UTR Luciferase Stable Cell Line

TU017249 1.0 ml
EUR 1394

Human Purinergic Receptor P2X 4 (P2RX4) ELISA Kit

abx382012-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

P2RX4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV691975 1.0 ug DNA
EUR 682

P2RX4 Rabbit Polyclonal Antibody