PAIP1 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

PAIP1 Polyclonal Antibody
30695-50ul 50ul
EUR 187
PAIP1 Polyclonal Antibody
ABP59815-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of PAIP1 from Human, Mouse. This PAIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180
PAIP1 Polyclonal Antibody
ABP59815-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of PAIP1 from Human, Mouse. This PAIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180
PAIP1 Polyclonal Antibody
ABP59815-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of PAIP1 from Human, Mouse. This PAIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180
PAIP1 Polyclonal Antibody
ES10018-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PAIP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PAIP1 Polyclonal Antibody
ES10018-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PAIP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PAIP1 Rabbit pAb
A6042-100ul 100 ul
EUR 308
PAIP1 Rabbit pAb
A6042-200ul 200 ul
EUR 459
PAIP1 Rabbit pAb
A6042-20ul 20 ul
EUR 183
PAIP1 Rabbit pAb
A6042-50ul 50 ul
EUR 223
PAIP1 Polyclonal Conjugated Antibody
C30695 100ul
EUR 397
PAIP1 antibody
70R-19094 50 ul
EUR 435
Description: Rabbit polyclonal PAIP1 antibody
PAIP1 antibody
70R-1375 100 ug
EUR 377
Description: Rabbit polyclonal PAIP1 antibody
PAIP1 Antibody
1-CSB-PA880930ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PAIP1. Recognizes PAIP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:200-1:1000
PAIP1 Antibody
1-CSB-PA017400GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PAIP1. Recognizes PAIP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF
PAIP1 antibody
70R-4907 50 ug
EUR 467
Description: Rabbit polyclonal PAIP1 antibody
anti- PAIP1 antibody
FNab06116 100µg
EUR 505.25
  • Immunogen: poly(A) binding protein interacting protein 1
  • Uniprot ID: Q9H074
  • Gene ID: 10605
  • Research Area: Metabolism
Description: Antibody raised against PAIP1
Anti-PAIP1 antibody
PAab06116 100 ug
EUR 355
Anti-PAIP1 antibody
STJ27838 100 µl
EUR 277
Description: The protein encoded by this gene interacts with poly(A)-binding protein and with the cap-binding complex eIF4A. It is involved in translational initiation and protein biosynthesis. Overexpression of this gene in COS7 cells stimulates translation. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified.
Anti-PAIP1 antibody
STJ191176 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PAIP1
PAIP1 siRNA
20-abx927633
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PAIP1 siRNA
20-abx927634
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-PAIP1
YF-PA25626 50 ul
EUR 334
Description: Mouse polyclonal to PAIP1
PAIP1 Blocking Peptide
33R-2650 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAIP1 antibody, catalog no. 70R-1375
PAIP1 Blocking Peptide
33R-6406 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAIP1 antibody, catalog no. 70R-4907
PAIP1 cloning plasmid
CSB-CL880930HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1203
  • Sequence: atgtcggacggtttcgatcgggccccagagcaaacgaggcccctgagagctccacctagttcacaggataaaatcccacagcagaactcggagtcagcaatggctaagccccaggtggttgtagctcctgtattaatgtctaagctgtctgtgaatgcccctgaattttaccctt
  • Show more
Description: A cloning plasmid for the PAIP1 gene.
pCMV-SPORT6-PAIP1
PVT13177 2 ug
EUR 391
Anti-PAIP1 (7E7)
YF-MA17395 200 ul
EUR 363
Description: Mouse monoclonal to PAIP1
Anti-PAIP1 (2D11)
YF-MA17396 50 ug
EUR 363
Description: Mouse monoclonal to PAIP1
Human PAIP1 ELISA KIT
ELI-14704h 96 Tests
EUR 824
PAIP1 ELISA KIT|Human
EF001531 96 Tests
EUR 689
Mouse Paip1 ELISA KIT
ELI-45095m 96 Tests
EUR 865
Human PAIP1 shRNA Plasmid
20-abx957218
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse PAIP1 shRNA Plasmid
20-abx981209
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PAIP1 Recombinant Protein (Human)
RP022468 100 ug Ask for price
PAIP1 Recombinant Protein (Mouse)
RP159935 100 ug Ask for price
PAIP1 Recombinant Protein (Mouse)
RP159938 100 ug Ask for price
PAIP1 Recombinant Protein (Rat)
RP219182 100 ug Ask for price
Paip1 ORF Vector (Rat) (pORF)
ORF073062 1.0 ug DNA
EUR 506
PAIP1 ORF Vector (Human) (pORF)
ORF007490 1.0 ug DNA
EUR 95
Paip1 ORF Vector (Mouse) (pORF)
ORF053313 1.0 ug DNA
EUR 506
Paip1 ORF Vector (Mouse) (pORF)
ORF053314 1.0 ug DNA
EUR 506
Paip1 sgRNA CRISPR Lentivector set (Rat)
K6112701 3 x 1.0 ug
EUR 339
Paip1 sgRNA CRISPR Lentivector set (Mouse)
K4580901 3 x 1.0 ug
EUR 339
PAIP1 sgRNA CRISPR Lentivector set (Human)
K1589401 3 x 1.0 ug
EUR 339
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody
20-abx004650
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody
20-abx142125
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody
abx030721-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody
abx030721-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody
abx340003-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody
20-abx321424
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody
abx236116-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody
abx236117-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Paip1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6112702 1.0 ug DNA
EUR 154
Paip1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6112703 1.0 ug DNA
EUR 154
Paip1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6112704 1.0 ug DNA
EUR 154
Paip1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4580902 1.0 ug DNA
EUR 154
Paip1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4580903 1.0 ug DNA
EUR 154
Paip1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4580904 1.0 ug DNA
EUR 154
PAIP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1589402 1.0 ug DNA
EUR 154
PAIP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1589403 1.0 ug DNA
EUR 154
PAIP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1589404 1.0 ug DNA
EUR 154
PAIP1 Protein Vector (Rat) (pPB-C-His)
PV292246 500 ng
EUR 603
PAIP1 Protein Vector (Rat) (pPB-N-His)
PV292247 500 ng
EUR 603
PAIP1 Protein Vector (Rat) (pPM-C-HA)
PV292248 500 ng
EUR 603
PAIP1 Protein Vector (Rat) (pPM-C-His)
PV292249 500 ng
EUR 603
PAIP1 Protein Vector (Mouse) (pPB-C-His)
PV213250 500 ng
EUR 603
PAIP1 Protein Vector (Mouse) (pPB-N-His)
PV213251 500 ng
EUR 603
PAIP1 Protein Vector (Mouse) (pPM-C-HA)
PV213252 500 ng
EUR 603
PAIP1 Protein Vector (Mouse) (pPM-C-His)
PV213253 500 ng
EUR 603
PAIP1 Protein Vector (Mouse) (pPB-C-His)
PV213254 500 ng
EUR 603
PAIP1 Protein Vector (Mouse) (pPB-N-His)
PV213255 500 ng
EUR 603
PAIP1 Protein Vector (Mouse) (pPM-C-HA)
PV213256 500 ng
EUR 603
PAIP1 Protein Vector (Mouse) (pPM-C-His)
PV213257 500 ng
EUR 603
PAIP1 Protein Vector (Human) (pPB-C-His)
PV029957 500 ng
EUR 329
PAIP1 Protein Vector (Human) (pPB-N-His)
PV029958 500 ng
EUR 329
PAIP1 Protein Vector (Human) (pPM-C-HA)
PV029959 500 ng
EUR 329
PAIP1 Protein Vector (Human) (pPM-C-His)
PV029960 500 ng
EUR 329
Paip1 3'UTR Luciferase Stable Cell Line
TU115857 1.0 ml Ask for price
Paip1 3'UTR GFP Stable Cell Line
TU165857 1.0 ml Ask for price
Paip1 3'UTR GFP Stable Cell Line
TU265768 1.0 ml Ask for price
Paip1 3'UTR Luciferase Stable Cell Line
TU215768 1.0 ml Ask for price
PAIP1 3'UTR GFP Stable Cell Line
TU067340 1.0 ml
EUR 1394
PAIP1 3'UTR Luciferase Stable Cell Line
TU017340 1.0 ml
EUR 1394
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

PAIP1 Rabbit Polyclonal Antibody