PCM1 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

PCM1 Polyclonal Antibody

ABP59847-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PCM1 protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of PCM1 from Human, Mouse. This PCM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PCM1 protein at amino acid sequence of 140-220

PCM1 Polyclonal Antibody

ABP59847-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PCM1 protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of PCM1 from Human, Mouse. This PCM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PCM1 protein at amino acid sequence of 140-220

PCM1 Polyclonal Antibody

ABP59847-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PCM1 protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of PCM1 from Human, Mouse. This PCM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PCM1 protein at amino acid sequence of 140-220

PCM1 Rabbit pAb

A5696-100ul 100 ul
EUR 308

PCM1 Rabbit pAb

A5696-200ul 200 ul
EUR 459

PCM1 Rabbit pAb

A5696-20ul 20 ul
EUR 183

PCM1 Rabbit pAb

A5696-50ul 50 ul
EUR 223

PCM1 Rabbit pAb

A16637-100ul 100 ul
EUR 308

PCM1 Rabbit pAb

A16637-200ul 200 ul
EUR 459

PCM1 Rabbit pAb

A16637-20ul 20 ul
EUR 183

PCM1 Rabbit pAb

A16637-50ul 50 ul
EUR 223

PCM1 Antibody

ABD7464 100 ug
EUR 438

PCM1 Antibody

32982-100ul 100ul
EUR 252

PCM1 Antibody

DF7464 200ul
EUR 304
Description: PCM1 Antibody detects endogenous levels of total PCM1.

PCM1 Antibody

1-CSB-PA618977DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PCM1. Recognizes PCM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PCM1 Conjugated Antibody

C32982 100ul
EUR 397

anti- PCM1 antibody

FNab06212 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: pericentriolar material 1
  • Uniprot ID: Q15154
  • Gene ID: 5108
  • Research Area: Epigenetics
Description: Antibody raised against PCM1

Anti-PCM1 antibody

PAab06212 100 ug
EUR 386

Anti-PCM1 antibody

STJ27663 100 µl
EUR 277
Description: The protein encoded by this gene is a component of centriolar satellites, which are electron dense granules scattered around centrosomes. Inhibition studies show that this protein is essential for the correct localization of several centrosomal proteins, and for anchoring microtubules to the centrosome. Chromosomal aberrations involving this gene are associated with papillary thyroid carcinomas and a variety of hematological malignancies, including atypical chronic myeloid leukemia and T-cell lymphoma. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-PCM1 antibody

STJ119072 100 µl
EUR 277

Anti-PCM1 antibody

STJ191134 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PCM1

PCM1 siRNA

20-abx927961
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PCM1 siRNA

20-abx927962
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-PCM1

PVT18447 2 ug
EUR 231

anti-PCM1

YF-PA13648 50 ug
EUR 363
Description: Mouse polyclonal to PCM1

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Human)

4-PAC715Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCM1 (Pro1913~Ile2024)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pericentriolar Material 1 (PCM1)

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Rat)

4-PAC715Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCM1 (Gln15~Val210)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pericentriolar Material 1 (PCM1)

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Human), APC

4-PAC715Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCM1 (Pro1913~Ile2024)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pericentriolar Material 1 (PCM1). This antibody is labeled with APC.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Human), Biotinylated

4-PAC715Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCM1 (Pro1913~Ile2024)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pericentriolar Material 1 (PCM1). This antibody is labeled with Biotin.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Human), Cy3

4-PAC715Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCM1 (Pro1913~Ile2024)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pericentriolar Material 1 (PCM1). This antibody is labeled with Cy3.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Human), FITC

4-PAC715Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCM1 (Pro1913~Ile2024)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pericentriolar Material 1 (PCM1). This antibody is labeled with FITC.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Human), HRP

4-PAC715Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCM1 (Pro1913~Ile2024)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pericentriolar Material 1 (PCM1). This antibody is labeled with HRP.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Human), PE

4-PAC715Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCM1 (Pro1913~Ile2024)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pericentriolar Material 1 (PCM1). This antibody is labeled with PE.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Rat), APC

4-PAC715Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCM1 (Gln15~Val210)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pericentriolar Material 1 (PCM1). This antibody is labeled with APC.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Rat), Biotinylated

4-PAC715Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCM1 (Gln15~Val210)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pericentriolar Material 1 (PCM1). This antibody is labeled with Biotin.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Rat), Cy3

4-PAC715Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCM1 (Gln15~Val210)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pericentriolar Material 1 (PCM1). This antibody is labeled with Cy3.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Rat), FITC

4-PAC715Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCM1 (Gln15~Val210)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pericentriolar Material 1 (PCM1). This antibody is labeled with FITC.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Rat), HRP

4-PAC715Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCM1 (Gln15~Val210)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pericentriolar Material 1 (PCM1). This antibody is labeled with HRP.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Rat), PE

4-PAC715Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCM1 (Gln15~Val210)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pericentriolar Material 1 (PCM1). This antibody is labeled with PE.

PCM1 cloning plasmid

CSB-CL618977HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1593
  • Sequence: atggccacaggaggaggtccctttgaagatggcatgaatgatcaggatttaccaaactggagtaatgagaatgttgatgacaggctcaacaatatggattggggtgcccaacagaagaaagcaaatagatcatcagaaaagaataagaaaaagtttggtgtagaaagtgataaaa
  • Show more
Description: A cloning plasmid for the PCM1 gene.

PCM1 Blocking Peptide

DF7464-BP 1mg
EUR 195

pENTR223-PCM1 vector

PVT11802 2 ug
EUR 304

Pericentriolar Material 1 (PCM1) Antibody

20-abx131505
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pericentriolar Material 1 (PCM1) Antibody

20-abx131506
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Human), APC-Cy7

4-PAC715Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCM1 (Pro1913~Ile2024)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pericentriolar Material 1 (PCM1). This antibody is labeled with APC-Cy7.

Pericentriolar Material 1 (PCM1) Polyclonal Antibody (Rat), APC-Cy7

4-PAC715Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCM1 (Gln15~Val210)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pericentriolar Material 1 (PCM1). This antibody is labeled with APC-Cy7.

PCM1 ELISA KIT|Human

EF001609 96 Tests
EUR 689

Human PCM1 shRNA Plasmid

20-abx953399
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PCM1 shRNA Plasmid

20-abx971944
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pECMV-3-FLAG-PCM1

PVT13554 2 ug
EUR 599

Pericentriolar Material 1 Protein (PCM1) Antibody

20-abx142128
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Pericentriolar Material 1 Protein (PCM1) Antibody

20-abx004357
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Pericentriolar Material 1 Protein (PCM1) Antibody

20-abx320670
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Pericentriolar Material 1 Protein (PCM1) Antibody

abx236212-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

PCM1 ORF Vector (Human) (pORF)

ORF007587 1.0 ug DNA
EUR 95

Pcm1 ORF Vector (Rat) (pORF)

ORF073211 1.0 ug DNA
EUR 2210

Pcm1 ORF Vector (Mouse) (pORF)

ORF053564 1.0 ug DNA
EUR 2209

Recombinant Pericentriolar Material 1 (PCM1)

4-RPC715Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15154
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Pericentriolar Material 1 expressed in: E.coli

Recombinant Pericentriolar Material 1 (PCM1)

4-RPC715Ra01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: G3V7E6
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Pericentriolar Material 1 expressed in: E.coli

PCM1 ELISA Kit (Human) (OKCA01412)

OKCA01412 96 Wells
EUR 846
Description: Description of target: Required for centrosome assembly and function. Essential for the correct localization of several centrosomal proteins including CEP250, CETN3, PCNT and NEK2. Required to anchor microtubules to the centrosome. Involved in the biogenesis of cilia.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 3.9 pg/mL

Human Pericentriolar Material 1 (PCM1) Protein

20-abx650135
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Pericentriolar Material 1 (PCM1) Protein

20-abx650136
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

PCM1 sgRNA CRISPR Lentivector set (Human)

K1611301 3 x 1.0 ug
EUR 339

Pcm1 sgRNA CRISPR Lentivector set (Mouse)

K4895301 3 x 1.0 ug
EUR 339

Pcm1 sgRNA CRISPR Lentivector set (Rat)

K7113401 3 x 1.0 ug
EUR 339

PCM1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1611302 1.0 ug DNA
EUR 154

PCM1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1611303 1.0 ug DNA
EUR 154

PCM1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1611304 1.0 ug DNA
EUR 154

Pcm1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4895302 1.0 ug DNA
EUR 154

Pcm1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4895303 1.0 ug DNA
EUR 154

Pcm1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4895304 1.0 ug DNA
EUR 154

Pcm1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7113402 1.0 ug DNA
EUR 154

Pcm1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7113403 1.0 ug DNA
EUR 154

Pcm1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7113404 1.0 ug DNA
EUR 154

PCM1 Protein Vector (Human) (pPB-C-His)

PV030345 500 ng
EUR 329

PCM1 Protein Vector (Human) (pPB-N-His)

PV030346 500 ng
EUR 329

PCM1 Protein Vector (Human) (pPM-C-HA)

PV030347 500 ng
EUR 329

PCM1 Protein Vector (Human) (pPM-C-His)

PV030348 500 ng
EUR 329

PCM1 Protein Vector (Mouse) (pPB-C-His)

PV214254 500 ng
EUR 3337

PCM1 Protein Vector (Mouse) (pPB-N-His)

PV214255 500 ng
EUR 3337

PCM1 Protein Vector (Mouse) (pPM-C-HA)

PV214256 500 ng
EUR 3337

PCM1 Protein Vector (Mouse) (pPM-C-His)

PV214257 500 ng
EUR 3337

PCM1 Protein Vector (Rat) (pPB-C-His)

PV292842 500 ng
EUR 3339

PCM1 Protein Vector (Rat) (pPB-N-His)

PV292843 500 ng
EUR 3339

PCM1 Protein Vector (Rat) (pPM-C-HA)

PV292844 500 ng
EUR 3339

PCM1 Protein Vector (Rat) (pPM-C-His)

PV292845 500 ng
EUR 3339

Pcm1 3'UTR GFP Stable Cell Line

TU166049 1.0 ml Ask for price

PCM1 3'UTR Luciferase Stable Cell Line

TU017564 1.0 ml
EUR 4617

Pcm1 3'UTR Luciferase Stable Cell Line

TU116049 1.0 ml Ask for price

PCM1 3'UTR GFP Stable Cell Line

TU067564 1.0 ml
EUR 4617

Pcm1 3'UTR GFP Stable Cell Line

TU265941 1.0 ml Ask for price

Pcm1 3'UTR Luciferase Stable Cell Line

TU215941 1.0 ml Ask for price

Human Pericentriolar material 1 protein, PCM1 ELISA KIT

ELI-21518h 96 Tests
EUR 824

Mouse Pericentriolar material 1 protein, Pcm1 ELISA KIT

ELI-21879m 96 Tests
EUR 865

Chicken Pericentriolar material 1 protein, PCM1 ELISA KIT

ELI-45850c 96 Tests
EUR 928

Human Pericentriolar material 1 protein (PCM1) ELISA Kit

abx382097-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

PCM1 Rabbit Polyclonal Antibody