PECR Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

PECR Polyclonal Antibody
30855-50ul 50ul
EUR 187
PECR Polyclonal Antibody
A60226 100 µg
EUR 570.55
Description: kits suitable for this type of research
PECR Polyclonal Antibody
ABP59875-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of PECR from Human, Mouse, Rat. This PECR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120
PECR Polyclonal Antibody
ABP59875-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of PECR from Human, Mouse, Rat. This PECR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120
PECR Polyclonal Antibody
ABP59875-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of PECR from Human, Mouse, Rat. This PECR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120
PECR Polyclonal Antibody
ES9983-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PECR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
PECR Polyclonal Antibody
ES9983-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PECR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
PECR Rabbit pAb
A7206-100ul 100 ul
EUR 308
PECR Rabbit pAb
A7206-200ul 200 ul
EUR 459
PECR Rabbit pAb
A7206-20ul 20 ul
EUR 183
PECR Rabbit pAb
A7206-50ul 50 ul
EUR 223
PECR Polyclonal Conjugated Antibody
C30855 100ul
EUR 397
PECR antibody
22145-100ul 100ul
EUR 390
PECR antibody
70R-19207 50 ul
EUR 435
Description: Rabbit polyclonal PECR antibody
PECR antibody
70R-13465 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PECR antibody
PECR antibody
10R-5232 100 ul
EUR 726
Description: Mouse monoclonal PECR antibody
PECR antibody
10R-5233 100 ul
EUR 691
Description: Mouse monoclonal PECR antibody
PECR antibody
10R-5235 100 ul
EUR 691
Description: Mouse monoclonal PECR antibody
PECR Antibody
1-CSB-PA017769ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
PECR Antibody
1-CSB-PA017769ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
PECR Antibody
1-CSB-PA017769GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
PECR Antibody
1-CSB-PA017769LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is Unconjugated. Tested in the following application: ELISA
PECR Polyclonal Antibody, Biotin Conjugated
A60227 100 µg
EUR 570.55
Description: fast delivery possible
PECR Polyclonal Antibody, FITC Conjugated
A60228 100 µg
EUR 570.55
Description: reagents widely cited
PECR Polyclonal Antibody, HRP Conjugated
A60229 100 µg
EUR 570.55
Description: Ask the seller for details
Polyclonal PECR antibody - C-terminal region
APR09035G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PECR - C-terminal region. This antibody is tested and proven to work in the following applications:
Pecr/ Rat Pecr ELISA Kit
ELI-37732r 96 Tests
EUR 886
Human PECR Antibody
33241-05111 150 ug
EUR 261
anti- PECR antibody
FNab06300 100µg
EUR 548.75
  • Immunogen: peroxisomal trans-2-enoyl-CoA reductase
  • Uniprot ID: Q9BY49
  • Gene ID: 55825
  • Research Area: Metabolism
Description: Antibody raised against PECR
Anti-PECR antibody
PAab06300 100 ug
EUR 386
Anti-PECR antibody
STJ29286 100 µl
EUR 277
Anti-PECR antibody
STJ191141 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PECR
PECR siRNA
20-abx903934
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PECR siRNA
20-abx928223
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PECR siRNA
20-abx928224
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pOTB7-PECR
PVT18639 2 ug
EUR 231
PECR Antibody, HRP conjugated
1-CSB-PA017769LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PECR Antibody, FITC conjugated
1-CSB-PA017769LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PECR Antibody, Biotin conjugated
1-CSB-PA017769LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
PECR cloning plasmid
CSB-CL017769HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 912
  • Sequence: atggcctcctgggctaagggcaggagctacctggcgcctggtttgctgcagggccaagtggccatcgtcaccggcggggccacgggcatcggaaaagccatcgtgaaggagctcctggagctggggagtaatgtggtcattgcatcccgtaagttggagagattgaagtctgcggc
  • Show more
Description: A cloning plasmid for the PECR gene.
Anti-PECR (2F10)
YF-MA18843 200 ul
EUR 363
Description: Mouse monoclonal to PECR
Human PECR Antibody (Biotin Conjugate)
33241-05121 150 ug
EUR 369
PECR protein (His tag)
80R-1994 100 ug
EUR 322
Description: Recombinant human PECR protein (His tag)
PECR ELISA KIT|Human
EF001670 96 Tests
EUR 689
Rat PECR shRNA Plasmid
20-abx987129
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human PECR shRNA Plasmid
20-abx960951
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse PECR shRNA Plasmid
20-abx980128
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PECR Recombinant Protein (Human)
RP023053 100 ug Ask for price
PECR Recombinant Protein (Mouse)
RP161288 100 ug Ask for price
PECR Recombinant Protein (Rat)
RP220010 100 ug Ask for price
Human PECR AssayLite Antibody (FITC Conjugate)
33241-05141 150 ug
EUR 428
Human PECR AssayLite Antibody (RPE Conjugate)
33241-05151 150 ug
EUR 428
Human PECR AssayLite Antibody (APC Conjugate)
33241-05161 150 ug
EUR 428
Human PECR AssayLite Antibody (PerCP Conjugate)
33241-05171 150 ug
EUR 471
Pecr ORF Vector (Rat) (pORF)
ORF073338 1.0 ug DNA
EUR 506
PECR ORF Vector (Human) (pORF)
ORF007685 1.0 ug DNA
EUR 95
Pecr ORF Vector (Mouse) (pORF)
ORF053764 1.0 ug DNA
EUR 506
Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody
20-abx006438
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody
20-abx320845
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody
abx236300-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody
20-abx321842
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody
20-abx304789
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Pecr sgRNA CRISPR Lentivector set (Mouse)
K4951401 3 x 1.0 ug
EUR 339
Pecr sgRNA CRISPR Lentivector set (Rat)
K7028401 3 x 1.0 ug
EUR 339
PECR sgRNA CRISPR Lentivector set (Human)
K1626201 3 x 1.0 ug
EUR 339
Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody (HRP)
20-abx304790
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody (FITC)
20-abx304791
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody (Biotin)
20-abx304792
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Pecr sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4951402 1.0 ug DNA
EUR 154
Pecr sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4951403 1.0 ug DNA
EUR 154
Pecr sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4951404 1.0 ug DNA
EUR 154
Pecr sgRNA CRISPR Lentivector (Rat) (Target 1)
K7028402 1.0 ug DNA
EUR 154
Pecr sgRNA CRISPR Lentivector (Rat) (Target 2)
K7028403 1.0 ug DNA
EUR 154
Pecr sgRNA CRISPR Lentivector (Rat) (Target 3)
K7028404 1.0 ug DNA
EUR 154
PECR sgRNA CRISPR Lentivector (Human) (Target 1)
K1626202 1.0 ug DNA
EUR 154
PECR sgRNA CRISPR Lentivector (Human) (Target 2)
K1626203 1.0 ug DNA
EUR 154
PECR sgRNA CRISPR Lentivector (Human) (Target 3)
K1626204 1.0 ug DNA
EUR 154
PECR Protein Vector (Rat) (pPB-C-His)
PV293350 500 ng
EUR 603
PECR Protein Vector (Rat) (pPB-N-His)
PV293351 500 ng
EUR 603
PECR Protein Vector (Rat) (pPM-C-HA)
PV293352 500 ng
EUR 603
PECR Protein Vector (Rat) (pPM-C-His)
PV293353 500 ng
EUR 603
PECR Protein Vector (Mouse) (pPB-C-His)
PV215054 500 ng
EUR 603
PECR Protein Vector (Mouse) (pPB-N-His)
PV215055 500 ng
EUR 603
PECR Protein Vector (Mouse) (pPM-C-HA)
PV215056 500 ng
EUR 603
PECR Protein Vector (Mouse) (pPM-C-His)
PV215057 500 ng
EUR 603
PECR Protein Vector (Human) (pPB-C-His)
PV030737 500 ng
EUR 329
PECR Protein Vector (Human) (pPB-N-His)
PV030738 500 ng
EUR 329
PECR Protein Vector (Human) (pPM-C-HA)
PV030739 500 ng
EUR 329
PECR Protein Vector (Human) (pPM-C-His)
PV030740 500 ng
EUR 329
Recombinant Human PECR Protein, His, E.coli-1mg
QP13004-1mg 1mg
EUR 2757
Recombinant Human PECR Protein, His, E.coli-20ug
QP13004-20ug 20ug
EUR 201
Recombinant Human PECR Protein, His, E.coli-5ug
QP13004-5ug 5ug
EUR 155
Pecr 3'UTR Luciferase Stable Cell Line
TU116181 1.0 ml Ask for price
Pecr 3'UTR GFP Stable Cell Line
TU166181 1.0 ml Ask for price
Pecr 3'UTR Luciferase Stable Cell Line
TU216068 1.0 ml Ask for price
Pecr 3'UTR GFP Stable Cell Line
TU266068 1.0 ml Ask for price
PECR 3'UTR GFP Stable Cell Line
TU067719 1.0 ml
EUR 1394
PECR 3'UTR Luciferase Stable Cell Line
TU017719 1.0 ml
EUR 1394
PECR Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV666409 1.0 ug DNA
EUR 514
PECR Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV666413 1.0 ug DNA
EUR 514
PECR Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV666414 1.0 ug DNA
EUR 514
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

PECR Rabbit Polyclonal Antibody