PEX16 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

PEX16 Polyclonal Antibody

ABP59882-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PEX16 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of PEX16 from Human, Mouse. This PEX16 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PEX16 protein at amino acid sequence of 100-180

PEX16 Polyclonal Antibody

ABP59882-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PEX16 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of PEX16 from Human, Mouse. This PEX16 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PEX16 protein at amino acid sequence of 100-180

PEX16 Polyclonal Antibody

ABP59882-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PEX16 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of PEX16 from Human, Mouse. This PEX16 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PEX16 protein at amino acid sequence of 100-180

PEX16 Polyclonal Antibody

27412-100ul 100ul
EUR 252

PEX16 Polyclonal Antibody

27412-50ul 50ul
EUR 187

PEX16 Rabbit pAb

A10387-100ul 100 ul
EUR 308

PEX16 Rabbit pAb

A10387-200ul 200 ul
EUR 459

PEX16 Rabbit pAb

A10387-20ul 20 ul
EUR 183

PEX16 Rabbit pAb

A10387-50ul 50 ul
EUR 223

PEX16 Polyclonal Conjugated Antibody

C27412 100ul
EUR 397

PEX16 antibody

70R-19220 50 ul
EUR 435
Description: Rabbit polyclonal PEX16 antibody

PEX16 Antibody

1-CSB-PA897573ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PEX16. Recognizes PEX16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PEX16 Antibody

DF12168 200ul
EUR 304
Description: PEX16 antibody detects endogenous levels of PEX16.

PEX16 Antibody

1-CSB-PA017801GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PEX16. Recognizes PEX16 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti- PEX16 antibody

FNab06328 100µg
EUR 505.25
  • Immunogen: peroxisomal biogenesis factor 16
  • Uniprot ID: Q9Y5Y5
  • Gene ID: 9409
  • Research Area: Signal Transduction
Description: Antibody raised against PEX16

Anti-PEX16 antibody

PAab06328 100 ug
EUR 355

Anti-PEX16 antibody

STJ112423 100 µl
EUR 277
Description: The protein encoded by this gene is an integral peroxisomal membrane protein. An inactivating nonsense mutation localized to this gene was observed in a patient with Zellweger syndrome of the complementation group CGD/CG9. Expression of this gene product morphologically and biochemically restores the formation of new peroxisomes, suggesting a role in peroxisome organization and biogenesis. Alternative splicing has been observed for this gene and two variants have been described.

Anti-PEX16 antibody

STJ191138 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PEX16

PEX16 siRNA

20-abx928280
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PEX16 siRNA

20-abx928281
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-PEX16

PVT18255 2 ug
EUR 231

Bovine Peroxisomal membrane protein PEX16, PEX16 ELISA KIT

ELI-21954b 96 Tests
EUR 928

Mouse Peroxisomal membrane protein PEX16, Pex16 ELISA KIT

ELI-15239m 96 Tests
EUR 865

Human Peroxisomal membrane protein PEX16, PEX16 ELISA KIT

ELI-45034h 96 Tests
EUR 824

PEX16 Blocking Peptide

DF12168-BP 1mg
EUR 195

PEX16 cloning plasmid

CSB-CL897573HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1011
  • Sequence: atggagaagctgcggctcctgggcctccgctaccaggagtacgtgactcgtcacccggccgccacggcccagctggagacagcagtgcggggcttcagttacctgctggcaggtcgattcgccgattcgcacgagctgtcagagctggtgtactctgcctctaacctgcttgtgc
  • Show more
Description: A cloning plasmid for the PEX16 gene.

Anti-PEX16 (3E10)

YF-MA16820 200 ul
EUR 363
Description: Mouse monoclonal to PEX16

PEX16 ELISA KIT|Human

EF001690 96 Tests
EUR 689

Human PEX16 shRNA Plasmid

20-abx956237
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PEX16 shRNA Plasmid

20-abx972003
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PEX16 Recombinant Protein (Human)

RP023134 100 ug Ask for price

PEX16 Recombinant Protein (Rat)

RP220088 100 ug Ask for price

PEX16 Recombinant Protein (Mouse)

RP161387 100 ug Ask for price

Peroxisomal Biogenesis Factor 16 (PEX16) Antibody

20-abx123682
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 16 (PEX16) Antibody

20-abx126350
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 16 (PEX16) Antibody

20-abx114406
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 16 (PEX16) Antibody

abx034247-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 16 (PEX16) Antibody

abx034247-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 16 (PEX16) Antibody

20-abx321341
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 16 (PEX16) Antibody

abx236328-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

PEX16 ORF Vector (Human) (pORF)

ORF007712 1.0 ug DNA
EUR 95

Pex16 ORF Vector (Rat) (pORF)

ORF073364 1.0 ug DNA
EUR 506

Pex16 ORF Vector (Mouse) (pORF)

ORF053797 1.0 ug DNA
EUR 506

PEX16 sgRNA CRISPR Lentivector set (Human)

K1629801 3 x 1.0 ug
EUR 339

Pex16 sgRNA CRISPR Lentivector set (Mouse)

K3261401 3 x 1.0 ug
EUR 339

Pex16 sgRNA CRISPR Lentivector set (Rat)

K7135401 3 x 1.0 ug
EUR 339

PEX16 sgRNA CRISPR Lentivector (Human) (Target 1)

K1629802 1.0 ug DNA
EUR 154

PEX16 sgRNA CRISPR Lentivector (Human) (Target 2)

K1629803 1.0 ug DNA
EUR 154

PEX16 sgRNA CRISPR Lentivector (Human) (Target 3)

K1629804 1.0 ug DNA
EUR 154

Pex16 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3261402 1.0 ug DNA
EUR 154

Pex16 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3261403 1.0 ug DNA
EUR 154

Pex16 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3261404 1.0 ug DNA
EUR 154

Pex16 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7135402 1.0 ug DNA
EUR 154

Pex16 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7135403 1.0 ug DNA
EUR 154

Pex16 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7135404 1.0 ug DNA
EUR 154

PEX16 Protein Vector (Human) (pPB-C-His)

PV030845 500 ng
EUR 329

PEX16 Protein Vector (Human) (pPB-N-His)

PV030846 500 ng
EUR 329

PEX16 Protein Vector (Human) (pPM-C-HA)

PV030847 500 ng
EUR 329

PEX16 Protein Vector (Human) (pPM-C-His)

PV030848 500 ng
EUR 329

PEX16 Protein Vector (Mouse) (pPB-C-His)

PV215186 500 ng
EUR 603

PEX16 Protein Vector (Mouse) (pPB-N-His)

PV215187 500 ng
EUR 603

PEX16 Protein Vector (Mouse) (pPM-C-HA)

PV215188 500 ng
EUR 603

PEX16 Protein Vector (Mouse) (pPM-C-His)

PV215189 500 ng
EUR 603

PEX16 Protein Vector (Rat) (pPB-C-His)

PV293454 500 ng
EUR 603

PEX16 Protein Vector (Rat) (pPB-N-His)

PV293455 500 ng
EUR 603

PEX16 Protein Vector (Rat) (pPM-C-HA)

PV293456 500 ng
EUR 603

PEX16 Protein Vector (Rat) (pPM-C-His)

PV293457 500 ng
EUR 603

Pex16 3'UTR GFP Stable Cell Line

TU166211 1.0 ml Ask for price

PEX16 3'UTR Luciferase Stable Cell Line

TU017756 1.0 ml
EUR 1394

Pex16 3'UTR Luciferase Stable Cell Line

TU116211 1.0 ml Ask for price

PEX16 3'UTR GFP Stable Cell Line

TU067756 1.0 ml
EUR 1394

Pex16 3'UTR GFP Stable Cell Line

TU266096 1.0 ml Ask for price

Pex16 3'UTR Luciferase Stable Cell Line

TU216096 1.0 ml Ask for price

Human Peroxisomal Biogenesis Factor 16 (PEX16) ELISA Kit

abx382161-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

PEX16 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV627007 1.0 ug DNA
EUR 514

PEX16 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV627011 1.0 ug DNA
EUR 514

PEX16 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV627012 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

PEX16 Rabbit Polyclonal Antibody