PGK2 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

PGK2 Polyclonal Antibody
ABP59889-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PGK2 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of PGK2 from Human, Mouse. This PGK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PGK2 protein at amino acid sequence of 80-160
PGK2 Polyclonal Antibody
ABP59889-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PGK2 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of PGK2 from Human, Mouse. This PGK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PGK2 protein at amino acid sequence of 80-160
PGK2 Polyclonal Antibody
ABP59889-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PGK2 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of PGK2 from Human, Mouse. This PGK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PGK2 protein at amino acid sequence of 80-160
PGK2 Polyclonal Antibody
ES9999-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PGK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PGK2 Polyclonal Antibody
ES9999-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PGK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PGK2 Rabbit pAb
A12952-100ul 100 ul
EUR 308
PGK2 Rabbit pAb
A12952-200ul 200 ul
EUR 459
PGK2 Rabbit pAb
A12952-20ul 20 ul
EUR 183
PGK2 Rabbit pAb
A12952-50ul 50 ul
EUR 223
PGK2 Rabbit pAb
A4017-100ul 100 ul
EUR 308
PGK2 Rabbit pAb
A4017-200ul 200 ul
EUR 459
PGK2 Rabbit pAb
A4017-20ul 20 ul Ask for price
PGK2 Rabbit pAb
A4017-50ul 50 ul Ask for price
PGK2 antibody
70R-19242 50 ul
EUR 435
Description: Rabbit polyclonal PGK2 antibody
PGK2 antibody
70R-2323 50 ug
EUR 467
Description: Rabbit polyclonal PGK2 antibody raised against the C terminal of PGK2
PGK2 Antibody
36193-100ul 100ul
EUR 252
PGK2 Antibody
1-CSB-PA145596
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200
PGK2 Antibody
1-CSB-PA017859GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
PGK2 Antibody
1-CSB-PA017859LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000
PGK2 Antibody
1-CSB-PA191316
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200
Polyclonal PGK2 Antibody (N-term)
APR09089G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PGK2 (N-term). This antibody is tested and proven to work in the following applications:
PGK2 Polyclonal Antibody, Biotin Conjugated
A60251 100 µg
EUR 570.55
Description: Ask the seller for details
PGK2 Polyclonal Antibody, FITC Conjugated
A60252 100 µg
EUR 570.55
Description: The best epigenetics products
PGK2 Polyclonal Antibody, HRP Conjugated
A60253 100 µg
EUR 570.55
Description: kits suitable for this type of research
Human PGK2 Antibody
32645-05111 150 ug
EUR 261
PGK2 Conjugated Antibody
C36193 100ul
EUR 397
anti- PGK2 antibody
FNab06355 100µg
EUR 548.75
  • Immunogen: phosphoglycerate kinase 2
  • Uniprot ID: P07205
  • Gene ID: 5232
  • Research Area: Metabolism
Description: Antibody raised against PGK2
Anti-PGK2 antibody
PAab06355 100 ug
EUR 386
Anti-PGK2 antibody
STJ26532 100 µl
EUR 277
Description: This gene is intronless, arose via retrotransposition of the phosphoglycerate kinase 1 gene, and is expressed specifically in the testis. Initially assumed to be a pseudogene, the encoded protein is actually a functional phosphoglycerate kinase that catalyzes the reversible conversion of 1,3-bisphosphoglycerate to 3-phosphoglycerate, during the Embden-Meyerhof-Parnas pathway of glycolysis, in the later stages of spermatogenesis.
Anti-PGK2 antibody
STJ114818 100 µl
EUR 277
Description: This gene is intronless, arose via retrotransposition of the phosphoglycerate kinase 1 gene, and is expressed specifically in the testis. Initially assumed to be a pseudogene, the encoded protein is actually a functional phosphoglycerate kinase that catalyzes the reversible conversion of 1,3-bisphosphoglycerate to 3-phosphoglycerate, during the Embden-Meyerhof-Parnas pathway of glycolysis, in the later stages of spermatogenesis.
Anti-PGK2 antibody
STJ191157 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PGK2
PGK2 siRNA
20-abx928366
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PGK2 siRNA
20-abx928367
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-PGK2
YF-PA24360 50 ul
EUR 334
Description: Mouse polyclonal to PGK2
PGK2 Antibody, HRP conjugated
1-CSB-PA017859LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PGK2 Antibody, FITC conjugated
1-CSB-PA017859LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PGK2 Antibody, Biotin conjugated
1-CSB-PA017859LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Rabbit Phosphoglycee kinase 2(PGK2) ELISA kit
E04P0843-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Phosphoglycee kinase 2(PGK2) ELISA kit
E04P0843-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Phosphoglycee kinase 2(PGK2) ELISA kit
E04P0843-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
PGK2 Blocking Peptide
33R-4189 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PGK2 antibody, catalog no. 70R-2323
PGK2, human recombinant
7820-50
EUR 501
PGK2 cloning plasmid
CSB-CL017859HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1254
  • Sequence: atgtctctttctaagaagttgactttagacaaactggatgttagagggaagcgagtcatcatgagagtagacttcaatgttcccatgaagaagaaccagattacaaacaaccagaggatcaaggcttccatcccaagcatcaagtactgcctggacaatggagccaaggcagtag
  • Show more
Description: A cloning plasmid for the PGK2 gene.
Human PGK2 Antibody (Biotin Conjugate)
32645-05121 150 ug
EUR 369
Phosphoglycerate Kinase 2 (PGK2) Antibody
20-abx002947
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Phosphoglycerate Kinase 2 (PGK2) Antibody
20-abx114469
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Phosphoglycerate Kinase 2 (PGK2) Antibody
abx146476-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Phosphoglycerate Kinase 2 (PGK2) Antibody
abx033208-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Phosphoglycerate Kinase 2 (PGK2) Antibody
abx033208-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Phosphoglycerate Kinase 2 (PGK2) Antibody
20-abx241045
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Phosphoglycerate Kinase 2 (PGK2) Antibody
20-abx241046
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Phosphoglycerate Kinase 2 (PGK2) Antibody
abx236355-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Phosphoglycerate Kinase 2 (PGK2) Antibody
20-abx302642
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human PGK2 AssayLite Antibody (FITC Conjugate)
32645-05141 150 ug
EUR 428
Human PGK2 AssayLite Antibody (RPE Conjugate)
32645-05151 150 ug
EUR 428
Human PGK2 AssayLite Antibody (APC Conjugate)
32645-05161 150 ug
EUR 428
Human PGK2 AssayLite Antibody (PerCP Conjugate)
32645-05171 150 ug
EUR 471
Phosphoglycerate Kinase 2 (PGK2) Antibody (HRP)
20-abx304803
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Phosphoglycerate Kinase 2 (PGK2) Antibody (FITC)
20-abx304804
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Phosphoglycerate Kinase 2 (PGK2) Antibody (Biotin)
20-abx304805
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
PGK2 protein (His tag)
80R-2091 50 ug
EUR 424
Description: Recombinant human PGK2 protein (His tag)
PGK2 ELISA KIT|Human
EF001709 96 Tests
EUR 689
Mouse PGK2 shRNA Plasmid
20-abx972018
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human PGK2 shRNA Plasmid
20-abx953496
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PGK2 Recombinant Protein (Human)
RP023230 100 ug Ask for price
PGK2 Recombinant Protein (Mouse)
RP161579 100 ug Ask for price
PGK2 Recombinant Protein (Rat)
RP220214 100 ug Ask for price
Pgk2 ORF Vector (Rat) (pORF)
ORF073406 1.0 ug DNA
EUR 506
PGK2 ORF Vector (Human) (pORF)
ORF007744 1.0 ug DNA
EUR 95
Pgk2 ORF Vector (Mouse) (pORF)
ORF053861 1.0 ug DNA
EUR 506
Pgk2 sgRNA CRISPR Lentivector set (Rat)
K6046401 3 x 1.0 ug
EUR 339
Pgk2 sgRNA CRISPR Lentivector set (Mouse)
K3822201 3 x 1.0 ug
EUR 339
PGK2 sgRNA CRISPR Lentivector set (Human)
K1635001 3 x 1.0 ug
EUR 339
Rat Phosphoglycee kinase 2(PGK2) ELISA kit
E02P0843-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Phosphoglycee kinase 2(PGK2) ELISA kit
E02P0843-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Phosphoglycee kinase 2(PGK2) ELISA kit
E02P0843-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Phosphoglycee kinase 2(PGK2) ELISA kit
E03P0843-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Phosphoglycee kinase 2(PGK2) ELISA kit
E03P0843-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Phosphoglycee kinase 2(PGK2) ELISA kit
E03P0843-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Phosphoglycee kinase 2(PGK2) ELISA kit
E01P0843-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Phosphoglycee kinase 2(PGK2) ELISA kit
E01P0843-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Phosphoglycee kinase 2(PGK2) ELISA kit
E01P0843-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Phosphoglycee kinase 2(PGK2) ELISA kit
E06P0843-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Phosphoglycee kinase 2(PGK2) ELISA kit
E06P0843-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Phosphoglycee kinase 2(PGK2) ELISA kit
E06P0843-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Phosphoglycee kinase 2(PGK2) ELISA kit
E08P0843-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Phosphoglycee kinase 2(PGK2) ELISA kit
E08P0843-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Phosphoglycee kinase 2(PGK2) ELISA kit
E08P0843-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Phosphoglycee kinase 2(PGK2) ELISA kit
E07P0843-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Phosphoglycee kinase 2(PGK2) ELISA kit
E07P0843-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Phosphoglycee kinase 2(PGK2) ELISA kit
E07P0843-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Phosphoglycee kinase 2(PGK2) ELISA kit
E09P0843-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Phosphoglycee kinase 2(PGK2) ELISA kit
E09P0843-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Phosphoglycee kinase 2(PGK2) ELISA kit
E09P0843-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Phosphoglycerate kinase 2, Pgk2 ELISA KIT
ELI-15273m 96 Tests
EUR 865
Porcine Phosphoglycerate kinase 2, PGK2 ELISA KIT
ELI-20972p 96 Tests
EUR 928
Human Phosphoglycerate kinase 2, PGK2 ELISA KIT
ELI-22705h 96 Tests
EUR 824
Human Phosphoglycerate Kinase 2 (PGK2) ELISA Kit
abx382179-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Pgk2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6046402 1.0 ug DNA
EUR 154
Pgk2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6046403 1.0 ug DNA
EUR 154
Pgk2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6046404 1.0 ug DNA
EUR 154
Pgk2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3822202 1.0 ug DNA
EUR 154
Pgk2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3822203 1.0 ug DNA
EUR 154
Pgk2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3822204 1.0 ug DNA
EUR 154
PGK2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1635002 1.0 ug DNA
EUR 154
PGK2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1635003 1.0 ug DNA
EUR 154
PGK2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1635004 1.0 ug DNA
EUR 154
PGK2 Phosphoglycerate Kinase 2 Human Recombinant Protein
PROTP07205 Regular: 10ug
EUR 317
Description: PGK2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 437 amino acids (1-417 a.a.) and having a molecular mass of 46.9kDa.;PGK2 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
PGK2 Protein Vector (Rat) (pPB-C-His)
PV293622 500 ng
EUR 603
PGK2 Protein Vector (Rat) (pPB-N-His)
PV293623 500 ng
EUR 603
PGK2 Protein Vector (Rat) (pPM-C-HA)
PV293624 500 ng
EUR 603
PGK2 Protein Vector (Rat) (pPM-C-His)
PV293625 500 ng
EUR 603
PGK2 Protein Vector (Human) (pPB-C-His)
PV030973 500 ng
EUR 329
PGK2 Protein Vector (Human) (pPB-N-His)
PV030974 500 ng
EUR 329
PGK2 Protein Vector (Human) (pPM-C-HA)
PV030975 500 ng
EUR 329
PGK2 Protein Vector (Human) (pPM-C-His)
PV030976 500 ng
EUR 329
PGK2 Protein Vector (Mouse) (pPB-C-His)
PV215442 500 ng
EUR 603
PGK2 Protein Vector (Mouse) (pPB-N-His)
PV215443 500 ng
EUR 603
PGK2 Protein Vector (Mouse) (pPM-C-HA)
PV215444 500 ng
EUR 603

PGK2 Rabbit Polyclonal Antibody