PHC3 Rabbit Polyclonal Antibody

Order Now:

PHC3 Polyclonal Antibody

ABP59896-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PHC3 protein at amino acid sequence of 720-800
  • Applications tips:
Description: A polyclonal antibody for detection of PHC3 from Human, Mouse. This PHC3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PHC3 protein at amino acid sequence of 720-800

PHC3 Polyclonal Antibody

ES10019-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PHC3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PHC3 Polyclonal Antibody

ES10019-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PHC3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PHC3 Rabbit pAb

A14151-100ul 100 ul
EUR 308

PHC3 Rabbit pAb

A14151-200ul 200 ul
EUR 459

PHC3 Rabbit pAb

A14151-20ul 20 ul
EUR 183

PHC3 Rabbit pAb

A14151-50ul 50 ul
EUR 223

PHC3 Rabbit pAb

A6479-100ul 100 ul
EUR 308

PHC3 Rabbit pAb

A6479-200ul 200 ul
EUR 459

PHC3 Rabbit pAb

A6479-20ul 20 ul
EUR 183

PHC3 Rabbit pAb

A6479-50ul 50 ul
EUR 223

PHC3 antibody

38952-100ul 100ul
EUR 252

PHC3 Conjugated Antibody

C38952 100ul
EUR 397

Anti-PHC3 antibody

STJ28562 100 µl
EUR 277

Anti-PHC3 antibody

STJ116086 100 µl
EUR 277

Anti-PHC3 antibody

STJ191177 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PHC3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PHC3 cloning plasmid

CSB-CL847692HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 456
  • Sequence: atggcggaagcggaatttaaggaccatagtacagctatggatactgaaccaaacccgggaacatcttctgtgtcaacaacaaccagcagtaccaccaccaccaccatcaccacttcctcctctcgaatgcagcagccacagatctctgtctacagtggttcagaccgacatgctgt
  • Show more
Description: A cloning plasmid for the PHC3 gene.

PHC3 cloning plasmid

CSB-CL847692HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 408
  • Sequence: atggatactgaaccaaacccgggaacatcttctgtgtcaacaacaaccagcagtaccaccaccaccaccatcaccacttcctcctctcgaatgcagcagccacagatctctgtctacagtggttcagaccgacatgctgtacaggcattgcatcggccccccagctcagctgctca
  • Show more
Description: A cloning plasmid for the PHC3 gene.

PHC3 cloning plasmid

CSB-CL847692HU3-10ug 10ug
EUR 936
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2952
  • Show more
Description: A cloning plasmid for the PHC3 gene.


YF-PA20991 50 ul
EUR 363
Description: Mouse polyclonal to Anti-PHC3

Mouse PHC3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PHC3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyhomeotic-Like Protein 3 (PHC3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polyhomeotic-Like Protein 3 (PHC3) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phc3 ORF Vector (Rat) (pORF)

ORF073430 1.0 ug DNA
EUR 506

PHC3 ORF Vector (Human) (pORF)

ORF014060 1.0 ug DNA
EUR 354

PHC3 ORF Vector (Human) (pORF)

ORF007764 1.0 ug DNA
EUR 95

PHC3 ORF Vector (Human) (pORF)

ORF007765 1.0 ug DNA
EUR 95

Phc3 ORF Vector (Mouse) (pORF)

ORF053905 1.0 ug DNA
EUR 506

Phc3 ORF Vector (Mouse) (pORF)

ORF053906 1.0 ug DNA
EUR 506

Phc3 ORF Vector (Mouse) (pORF)

ORF053907 1.0 ug DNA
EUR 506

Phc3 ORF Vector (Mouse) (pORF)

ORF053908 1.0 ug DNA
EUR 506

Phc3 sgRNA CRISPR Lentivector set (Rat)

K6539501 3 x 1.0 ug
EUR 339

Phc3 sgRNA CRISPR Lentivector set (Mouse)

K4668601 3 x 1.0 ug
EUR 339

PHC3 sgRNA CRISPR Lentivector set (Human)

K1638401 3 x 1.0 ug
EUR 339

Phc3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6539502 1.0 ug DNA
EUR 154

Phc3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6539503 1.0 ug DNA
EUR 154

Phc3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6539504 1.0 ug DNA
EUR 154

Phc3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4668602 1.0 ug DNA
EUR 154

Phc3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4668603 1.0 ug DNA
EUR 154

Phc3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4668604 1.0 ug DNA
EUR 154

PHC3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1638402 1.0 ug DNA
EUR 154

PHC3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1638403 1.0 ug DNA
EUR 154

PHC3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1638404 1.0 ug DNA
EUR 154

PHC3 Protein Vector (Rat) (pPB-C-His)

PV293718 500 ng
EUR 1166

PHC3 Protein Vector (Rat) (pPB-N-His)

PV293719 500 ng
EUR 1166

PHC3 Protein Vector (Rat) (pPM-C-HA)

PV293720 500 ng
EUR 1166

PHC3 Protein Vector (Rat) (pPM-C-His)

PV293721 500 ng
EUR 1166

PHC3 Protein Vector (Human) (pPB-C-His)

PV031053 500 ng
EUR 329

PHC3 Protein Vector (Human) (pPB-N-His)

PV031054 500 ng
EUR 329

PHC3 Protein Vector (Human) (pPM-C-HA)

PV031055 500 ng
EUR 329

PHC3 Protein Vector (Human) (pPM-C-His)

PV031056 500 ng
EUR 329

PHC3 Protein Vector (Human) (pPB-C-His)

PV031057 500 ng
EUR 329

PHC3 Protein Vector (Human) (pPB-N-His)

PV031058 500 ng
EUR 329

PHC3 Protein Vector (Human) (pPM-C-HA)

PV031059 500 ng
EUR 329

PHC3 Protein Vector (Human) (pPM-C-His)

PV031060 500 ng
EUR 329

PHC3 Protein Vector (Human) (pPB-C-His)

PV056237 500 ng
EUR 481

PHC3 Protein Vector (Human) (pPB-N-His)

PV056238 500 ng
EUR 481

PHC3 Protein Vector (Human) (pPM-C-HA)

PV056239 500 ng
EUR 481

PHC3 Protein Vector (Human) (pPM-C-His)

PV056240 500 ng
EUR 481

PHC3 Protein Vector (Mouse) (pPB-C-His)

PV215618 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPB-N-His)

PV215619 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPM-C-HA)

PV215620 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPM-C-His)

PV215621 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPB-C-His)

PV215622 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPB-N-His)

PV215623 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPM-C-HA)

PV215624 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPM-C-His)

PV215625 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPB-C-His)

PV215626 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPB-N-His)

PV215627 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPM-C-HA)

PV215628 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPM-C-His)

PV215629 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPB-C-His)

PV215630 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPB-N-His)

PV215631 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPM-C-HA)

PV215632 500 ng
EUR 1065

PHC3 Protein Vector (Mouse) (pPM-C-His)

PV215633 500 ng
EUR 1065

Phc3 3'UTR Luciferase Stable Cell Line

TU116279 1.0 ml Ask for price

Phc3 3'UTR GFP Stable Cell Line

TU166279 1.0 ml Ask for price

Phc3 3'UTR Luciferase Stable Cell Line

TU216160 1.0 ml Ask for price

Phc3 3'UTR GFP Stable Cell Line

TU266160 1.0 ml Ask for price

PHC3 3'UTR GFP Stable Cell Line

TU067841 1.0 ml
EUR 1521

PHC3 3'UTR Luciferase Stable Cell Line

TU017841 1.0 ml
EUR 1521

Mouse Polyhomeotic- like protein 3, Phc3 ELISA KIT

ELI-16013m 96 Tests
EUR 865

Human Polyhomeotic- like protein 3, PHC3 ELISA KIT

ELI-43644h 96 Tests
EUR 824

PHC3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV713385 1.0 ug DNA
EUR 316

PHC3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV713389 1.0 ug DNA
EUR 316

PHC3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV713390 1.0 ug DNA
EUR 316

PHC3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV713391 1.0 ug DNA
EUR 316

PHC3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV713395 1.0 ug DNA
EUR 316

PHC3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV713396 1.0 ug DNA
EUR 316

PHC3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV704517 1.0 ug DNA
EUR 450

PHC3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV704521 1.0 ug DNA
EUR 450

PHC3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV704522 1.0 ug DNA
EUR 450

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

PHC3 Rabbit Polyclonal Antibody