PIGA Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

PIGA Polyclonal Antibody

ES9989-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PIGA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PIGA Polyclonal Antibody

ES9989-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PIGA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PIGA Rabbit pAb

A6236-100ul 100 ul
EUR 308

PIGA Rabbit pAb

A6236-200ul 200 ul
EUR 459

PIGA Rabbit pAb

A6236-20ul 20 ul
EUR 183

PIGA Rabbit pAb

A6236-50ul 50 ul
EUR 223

PIGA antibody

70R-19281 50 ul
EUR 435
Description: Rabbit polyclonal PIGA antibody

PIGA Antibody

46125-100ul 100ul
EUR 252

PIGA Antibody

46125-50ul 50ul
EUR 187

PIGA Antibody

DF9742 200ul
EUR 304
Description: PIGA Antibody detects endogenous levels of total PIGA.

PIGA Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PIGA Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

PIGA antibody

70R-6607 50 ug
EUR 467
Description: Rabbit polyclonal PIGA antibody raised against the middle region of PIGA

PIGA antibody

70R-8625 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PIGA antibody

PIGA Antibody

ABD9742 100 ug
EUR 438

Polyclonal PIGA Antibody (C-term)

APR03682G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PIGA (C-term). This antibody is tested and proven to work in the following applications:

PIGA Conjugated Antibody

C46125 100ul
EUR 397

anti- PIGA antibody

FNab06438 100µg
EUR 548.75
  • Immunogen: phosphatidylinositol glycan anchor biosynthesis, class A
  • Uniprot ID: P37287
  • Gene ID: 5277
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against PIGA

Anti-PIGA antibody

PAab06438 100 ug
EUR 386

Anti-PIGA antibody

STJ27992 100 µl
EUR 277
Description: This gene encodes a protein required for synthesis of N-acetylglucosaminyl phosphatidylinositol (GlcNAc-PI), the first intermediate in the biosynthetic pathway of GPI anchor. The GPI anchor is a glycolipid found on many blood cells and which serves to anchor proteins to the cell surface. Paroxysmal nocturnal hemoglobinuria, an acquired hematologic disorder, has been shown to result from mutations in this gene. Alternate splice variants have been characterized. A related pseudogene is located on chromosome 12.

Anti-PIGA antibody

STJ191147 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PIGA


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIGA Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PIGA Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PIGA Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PIGA Blocking Peptide

33R-8916 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PIGA antibody, catalog no. 70R-6607

PIGA Blocking Peptide

DF9742-BP 1mg
EUR 195

PIGA cloning plasmid

CSB-CL017965HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1455
  • Sequence: atggcctgtagaggaggagctgggaatggccaccgtgcctcagctacactctctcgggttagccctggaagtctttacacatgtagaacccgtacccataatatatgcatggtatctgactttttctacccaaatatgggaggcgtggaaagccacatttaccagctctctcagt
  • Show more
Description: A cloning plasmid for the PIGA gene.


EF001774 96 Tests
EUR 689

Mouse PIGA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PIGA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-36281h 96 Tests
EUR 824

Mouse Piga ELISA KIT

ELI-37394m 96 Tests
EUR 865

PIGA Recombinant Protein (Human)

RP023434 100 ug Ask for price

PIGA Recombinant Protein (Mouse)

RP162014 100 ug Ask for price

PIGA Recombinant Protein (Rat)

RP220463 100 ug Ask for price

Piga ORF Vector (Rat) (pORF)

ORF073489 1.0 ug DNA
EUR 506

PIGA ORF Vector (Human) (pORF)

ORF007812 1.0 ug DNA
EUR 95

Piga ORF Vector (Mouse) (pORF)

ORF054006 1.0 ug DNA
EUR 506

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody

abx026766-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody

abx026766-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (Piga) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody

abx236438-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Piga sgRNA CRISPR Lentivector set (Mouse)

K4985401 3 x 1.0 ug
EUR 339

Piga sgRNA CRISPR Lentivector set (Rat)

K6656901 3 x 1.0 ug
EUR 339

PIGA sgRNA CRISPR Lentivector set (Human)

K1646601 3 x 1.0 ug
EUR 339

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Piga sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4985402 1.0 ug DNA
EUR 154

Piga sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4985403 1.0 ug DNA
EUR 154

Piga sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4985404 1.0 ug DNA
EUR 154

Piga sgRNA CRISPR Lentivector (Rat) (Target 1)

K6656902 1.0 ug DNA
EUR 154

Piga sgRNA CRISPR Lentivector (Rat) (Target 2)

K6656903 1.0 ug DNA
EUR 154

Piga sgRNA CRISPR Lentivector (Rat) (Target 3)

K6656904 1.0 ug DNA
EUR 154

PIGA sgRNA CRISPR Lentivector (Human) (Target 1)

K1646602 1.0 ug DNA
EUR 154

PIGA sgRNA CRISPR Lentivector (Human) (Target 2)

K1646603 1.0 ug DNA
EUR 154

PIGA sgRNA CRISPR Lentivector (Human) (Target 3)

K1646604 1.0 ug DNA
EUR 154

PIGA Protein Vector (Rat) (pPB-C-His)

PV293954 500 ng
EUR 603

PIGA Protein Vector (Rat) (pPB-N-His)

PV293955 500 ng
EUR 603

PIGA Protein Vector (Rat) (pPM-C-HA)

PV293956 500 ng
EUR 603

PIGA Protein Vector (Rat) (pPM-C-His)

PV293957 500 ng
EUR 603

PIGA Protein Vector (Human) (pPB-C-His)

PV031245 500 ng
EUR 329

PIGA Protein Vector (Human) (pPB-N-His)

PV031246 500 ng
EUR 329

PIGA Protein Vector (Human) (pPM-C-HA)

PV031247 500 ng
EUR 329

PIGA Protein Vector (Human) (pPM-C-His)

PV031248 500 ng
EUR 329

PIGA Protein Vector (Mouse) (pPB-C-His)

PV216022 500 ng
EUR 603

PIGA Protein Vector (Mouse) (pPB-N-His)

PV216023 500 ng
EUR 603

PIGA Protein Vector (Mouse) (pPM-C-HA)

PV216024 500 ng
EUR 603

PIGA Protein Vector (Mouse) (pPM-C-His)

PV216025 500 ng
EUR 603

Piga 3'UTR Luciferase Stable Cell Line

TU116345 1.0 ml Ask for price

Piga 3'UTR GFP Stable Cell Line

TU166345 1.0 ml Ask for price

Piga 3'UTR Luciferase Stable Cell Line

TU216224 1.0 ml Ask for price

Piga 3'UTR GFP Stable Cell Line

TU266224 1.0 ml Ask for price

PIGA 3'UTR GFP Stable Cell Line

TU067926 1.0 ml
EUR 4617

PIGA 3'UTR Luciferase Stable Cell Line

TU017926 1.0 ml
EUR 4617

PIGA Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV622225 1.0 ug DNA
EUR 514

PIGA Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV622229 1.0 ug DNA
EUR 514

PIGA Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV622230 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

PIGA Rabbit Polyclonal Antibody