PIGC Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

PIGC Polyclonal Antibody

ABP59911-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PIGC protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of PIGC from Human, Mouse, Rat. This PIGC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGC protein at amino acid sequence of 170-250

PIGC Polyclonal Antibody

A60262 100 µg
EUR 570.55
Description: Ask the seller for details

PIGC Antibody

ABD9743 100 ug
EUR 438

PIGC Antibody

46126-100ul 100ul
EUR 252

PIGC Antibody

46126-50ul 50ul
EUR 187

PIGC antibody

70R-10196 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PIGC antibody

PIGC Antibody

DF9743 200ul
EUR 304
Description: PIGC Antibody detects endogenous levels of total PIGC.

PIGC Antibody

1-CSB-PA856402LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGC. Recognizes PIGC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

Polyclonal PIGC Antibody (C-Term)

AMM07169G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PIGC (C-Term). This antibody is tested and proven to work in the following applications:

PIGC Polyclonal Antibody, Biotin Conjugated

A60263 100 µg
EUR 570.55
Description: The best epigenetics products

PIGC Polyclonal Antibody, FITC Conjugated

A60264 100 µg
EUR 570.55
Description: kits suitable for this type of research

PIGC Polyclonal Antibody, HRP Conjugated

A60265 100 µg
EUR 570.55
Description: fast delivery possible

Polyclonal PIGC antibody - C-terminal region

AMM07170G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PIGC - C-terminal region. This antibody is tested and proven to work in the following applications:

Pigc/ Rat Pigc ELISA Kit

ELI-37395r 96 Tests
EUR 886

PIGC Conjugated Antibody

C46126 100ul
EUR 397

Anti-PIGC antibody

STJ191148 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PIGC

PIGC siRNA

20-abx904011
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIGC siRNA

20-abx928561
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIGC siRNA

20-abx928562
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PIGC

YF-PA24370 50 ul
EUR 334
Description: Mouse polyclonal to PIGC

PIGC Antibody, HRP conjugated

1-CSB-PA856402LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGC. Recognizes PIGC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PIGC Antibody, FITC conjugated

1-CSB-PA856402LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGC. Recognizes PIGC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PIGC Antibody, Biotin conjugated

1-CSB-PA856402LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGC. Recognizes PIGC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PIGC Blocking Peptide

33R-1593 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PIGC antibody, catalog no. 70R-10196

PIGC cloning plasmid

CSB-CL856402HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 894
  • Sequence: atgtatgctcaacctgtgactaacaccaaggaggtcaagtggcagaaggtcttgtatgagcgacagccctttcctgataactatgtggaccggcgattcctggaagagctccggaaaaacatccatgctcggaaataccaatattgggctgtggtatttgagtccagtgtggtgat
  • Show more
Description: A cloning plasmid for the PIGC gene.

PIGC Blocking Peptide

DF9743-BP 1mg
EUR 195

pENTR223-PIGC vector

PVT11696 2 ug
EUR 304

Anti-PIGC (1G2)

YF-MA14706 100 ug
EUR 363
Description: Mouse monoclonal to PIGC

Mouse PIGC shRNA Plasmid

20-abx976083
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Bovine PIGC ELISA KIT

ELI-22725b 96 Tests
EUR 928

Human PIGC ELISA KIT

ELI-22726h 96 Tests
EUR 824

Mouse Pigc ELISA KIT

ELI-35711m 96 Tests
EUR 865

Human PIGC shRNA Plasmid

20-abx953527
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PIGC shRNA Plasmid

20-abx990576
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PIGC Recombinant Protein (Human)

RP023437 100 ug Ask for price

PIGC Recombinant Protein (Rat)

RP220469 100 ug Ask for price

pECMV-3-FLAG-PIGC

PVT13332 2 ug
EUR 599

PIGC Recombinant Protein (Mouse)

RP162020 100 ug Ask for price

PIGC Recombinant Protein (Mouse)

RP162023 100 ug Ask for price

Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit C (PIGC) Antibody

20-abx310395
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit C (PIGC) Antibody

20-abx217764
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

PIGC ORF Vector (Human) (pORF)

ORF007813 1.0 ug DNA
EUR 95

Pigc ORF Vector (Rat) (pORF)

ORF073491 1.0 ug DNA
EUR 506

Pigc ORF Vector (Mouse) (pORF)

ORF054008 1.0 ug DNA
EUR 506

Pigc ORF Vector (Mouse) (pORF)

ORF054009 1.0 ug DNA
EUR 506

Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit C (PIGC) Antibody (HRP)

20-abx310396
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit C (PIGC) Antibody (FITC)

20-abx310397
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit C (PIGC) Antibody (Biotin)

20-abx310398
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PIGC sgRNA CRISPR Lentivector set (Human)

K1646901 3 x 1.0 ug
EUR 339

Pigc sgRNA CRISPR Lentivector set (Mouse)

K4909001 3 x 1.0 ug
EUR 339

Pigc sgRNA CRISPR Lentivector set (Rat)

K6625501 3 x 1.0 ug
EUR 339

PIGC sgRNA CRISPR Lentivector (Human) (Target 1)

K1646902 1.0 ug DNA
EUR 154

PIGC sgRNA CRISPR Lentivector (Human) (Target 2)

K1646903 1.0 ug DNA
EUR 154

PIGC sgRNA CRISPR Lentivector (Human) (Target 3)

K1646904 1.0 ug DNA
EUR 154

Pigc sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4909002 1.0 ug DNA
EUR 154

Pigc sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4909003 1.0 ug DNA
EUR 154

Pigc sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4909004 1.0 ug DNA
EUR 154

Pigc sgRNA CRISPR Lentivector (Rat) (Target 1)

K6625502 1.0 ug DNA
EUR 154

Pigc sgRNA CRISPR Lentivector (Rat) (Target 2)

K6625503 1.0 ug DNA
EUR 154

Pigc sgRNA CRISPR Lentivector (Rat) (Target 3)

K6625504 1.0 ug DNA
EUR 154

PIGC Protein Vector (Human) (pPB-C-His)

PV031249 500 ng
EUR 329

PIGC Protein Vector (Human) (pPB-N-His)

PV031250 500 ng
EUR 329

PIGC Protein Vector (Human) (pPM-C-HA)

PV031251 500 ng
EUR 329

PIGC Protein Vector (Human) (pPM-C-His)

PV031252 500 ng
EUR 329

PIGC Protein Vector (Mouse) (pPB-C-His)

PV216030 500 ng
EUR 603

PIGC Protein Vector (Mouse) (pPB-N-His)

PV216031 500 ng
EUR 603

PIGC Protein Vector (Mouse) (pPM-C-HA)

PV216032 500 ng
EUR 603

PIGC Protein Vector (Mouse) (pPM-C-His)

PV216033 500 ng
EUR 603

PIGC Protein Vector (Mouse) (pPB-C-His)

PV216034 500 ng
EUR 603

PIGC Protein Vector (Mouse) (pPB-N-His)

PV216035 500 ng
EUR 603

PIGC Protein Vector (Mouse) (pPM-C-HA)

PV216036 500 ng
EUR 603

PIGC Protein Vector (Mouse) (pPM-C-His)

PV216037 500 ng
EUR 603

PIGC Protein Vector (Rat) (pPB-C-His)

PV293962 500 ng
EUR 603

PIGC Protein Vector (Rat) (pPB-N-His)

PV293963 500 ng
EUR 603

PIGC Protein Vector (Rat) (pPM-C-HA)

PV293964 500 ng
EUR 603

PIGC Protein Vector (Rat) (pPM-C-His)

PV293965 500 ng
EUR 603

Pigc 3'UTR GFP Stable Cell Line

TU166347 1.0 ml Ask for price

PIGC 3'UTR Luciferase Stable Cell Line

TU017929 1.0 ml
EUR 1394

Pigc 3'UTR Luciferase Stable Cell Line

TU116347 1.0 ml Ask for price

PIGC 3'UTR GFP Stable Cell Line

TU067929 1.0 ml
EUR 1394

Pigc 3'UTR GFP Stable Cell Line

TU266226 1.0 ml Ask for price

Pigc 3'UTR Luciferase Stable Cell Line

TU216226 1.0 ml Ask for price

PIGC Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV692587 1.0 ug DNA
EUR 514

PIGC Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV692591 1.0 ug DNA
EUR 514

PIGC Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV692592 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PIGC Rabbit Polyclonal Antibody