PIGP Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

PIGP Polyclonal Antibody
ES9991-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PIGP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PIGP Polyclonal Antibody
ABP59912-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of PIGP from Human, Mouse. This PIGP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150
PIGP Polyclonal Antibody
ABP59912-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of PIGP from Human, Mouse. This PIGP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150
PIGP Polyclonal Antibody
ABP59912-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of PIGP from Human, Mouse. This PIGP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150
PIGP Rabbit pAb
A15446-100ul 100 ul
EUR 308
PIGP Rabbit pAb
A15446-200ul 200 ul
EUR 459
PIGP Rabbit pAb
A15446-20ul 20 ul
EUR 183
PIGP Rabbit pAb
A15446-50ul 50 ul
EUR 223
PIGP Antibody
ABD9744 100 ug
EUR 438
PIGP Antibody
46127-100ul 100ul
EUR 252
PIGP Antibody
46127-50ul 50ul
EUR 187
PIGP Antibody
DF9744 200ul
EUR 304
Description: PIGP Antibody detects endogenous levels of total PIGP.
PIGP Antibody
1-CSB-PA017979LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
PIGP Conjugated Antibody
C46127 100ul
EUR 397
anti- PIGP antibody
FNab06444 100µg
EUR 548.75
  • Immunogen: phosphatidylinositol glycan anchor biosynthesis, class P
  • Uniprot ID: P57054
  • Gene ID: 51227
  • Research Area: Metabolism
Description: Antibody raised against PIGP
Anti-PIGP antibody
PAab06444 100 ug
EUR 386
Anti-PIGP antibody
STJ117641 100 µl
EUR 277
Description: This gene encodes an enzyme involved in the first step of glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. The encoded protein is a component of the GPI-N-acetylglucosaminyltransferase complex that catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). This gene is located in the Down Syndrome critical region on chromosome 21 and is a candidate for the pathogenesis of Down syndrome. This gene has multiple pseudogenes and is a member of the phosphatidylinositol glycan anchor biosynthesis gene family. Alternatively spliced transcript variants encoding different isoforms have been described.
Anti-PIGP antibody
STJ191149 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PIGP
PIGP siRNA
20-abx928576
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PIGP siRNA
20-abx928577
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PIGP Antibody, HRP conjugated
1-CSB-PA017979LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PIGP Antibody, FITC conjugated
1-CSB-PA017979LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PIGP Antibody, Biotin conjugated
1-CSB-PA017979LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
PIGP cloning plasmid
CSB-CL017979HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 405
  • Sequence: atggtggaaaattcaccgtcgccattgccagaaagagcgatttatggctttgttcttttcttaagctcccaatttggcttcatactttacctcgtgtgggcctttattcctgaatcttggctaaactctttaggtttaacctattggcctcaaaaatattgggcagttgcattacc
  • Show more
Description: A cloning plasmid for the PIGP gene.
PIGP Blocking Peptide
DF9744-BP 1mg
EUR 195
Anti-PIGP (2E7)
YF-MA18446 100 ug
EUR 363
Description: Mouse monoclonal to PIGP
Mouse PIGP shRNA Plasmid
20-abx974629
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse Pigp ELISA KIT
ELI-22729m 96 Tests
EUR 865
PIGP ELISA KIT|Human
EF001781 96 Tests
EUR 689
Human PIGP ELISA KIT
ELI-43654h 96 Tests
EUR 824
Human PIGP shRNA Plasmid
20-abx959618
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PIGP Recombinant Protein (Human)
RP023473 100 ug Ask for price
PIGP Recombinant Protein (Rat)
RP220487 100 ug Ask for price
PIGP Recombinant Protein (Mouse)
RP162053 100 ug Ask for price
PIGP Recombinant Protein (Mouse)
RP162056 100 ug Ask for price
PIGP Recombinant Protein (Mouse)
RP162059 100 ug Ask for price
PIGP Recombinant Protein (Mouse)
RP162062 100 ug Ask for price
PIGP Recombinant Protein (Mouse)
RP162065 100 ug Ask for price
PIGP Recombinant Protein (Mouse)
RP162068 100 ug Ask for price
PIGP ORF Vector (Human) (pORF)
ORF007825 1.0 ug DNA
EUR 95
Pigp ORF Vector (Rat) (pORF)
ORF073497 1.0 ug DNA
EUR 506
Pigp ORF Vector (Mouse) (pORF)
ORF054019 1.0 ug DNA
EUR 506
Pigp ORF Vector (Mouse) (pORF)
ORF054020 1.0 ug DNA
EUR 506
Pigp ORF Vector (Mouse) (pORF)
ORF054021 1.0 ug DNA
EUR 506
Pigp ORF Vector (Mouse) (pORF)
ORF054022 1.0 ug DNA
EUR 506
Pigp ORF Vector (Mouse) (pORF)
ORF054023 1.0 ug DNA
EUR 506
Pigp ORF Vector (Mouse) (pORF)
ORF054024 1.0 ug DNA
EUR 506
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody
abx029081-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody
abx029081-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody
20-abx217767
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody
abx236444-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody
20-abx302113
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
PIGP sgRNA CRISPR Lentivector set (Human)
K1648001 3 x 1.0 ug
EUR 339
Pigp sgRNA CRISPR Lentivector set (Mouse)
K3106601 3 x 1.0 ug
EUR 339
Pigp sgRNA CRISPR Lentivector set (Rat)
K6548601 3 x 1.0 ug
EUR 339
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (HRP)
20-abx314272
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (FITC)
20-abx314273
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (Biotin)
20-abx314274
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
PIGP sgRNA CRISPR Lentivector (Human) (Target 1)
K1648002 1.0 ug DNA
EUR 154
PIGP sgRNA CRISPR Lentivector (Human) (Target 2)
K1648003 1.0 ug DNA
EUR 154
PIGP sgRNA CRISPR Lentivector (Human) (Target 3)
K1648004 1.0 ug DNA
EUR 154
Pigp sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3106602 1.0 ug DNA
EUR 154
Pigp sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3106603 1.0 ug DNA
EUR 154
Pigp sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3106604 1.0 ug DNA
EUR 154
Pigp sgRNA CRISPR Lentivector (Rat) (Target 1)
K6548602 1.0 ug DNA
EUR 154
Pigp sgRNA CRISPR Lentivector (Rat) (Target 2)
K6548603 1.0 ug DNA
EUR 154
Pigp sgRNA CRISPR Lentivector (Rat) (Target 3)
K6548604 1.0 ug DNA
EUR 154
PIGP Protein Vector (Human) (pPB-C-His)
PV031297 500 ng
EUR 329
PIGP Protein Vector (Human) (pPB-N-His)
PV031298 500 ng
EUR 329
PIGP Protein Vector (Human) (pPM-C-HA)
PV031299 500 ng
EUR 329
PIGP Protein Vector (Human) (pPM-C-His)
PV031300 500 ng
EUR 329
PIGP Protein Vector (Mouse) (pPB-C-His)
PV216074 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPB-N-His)
PV216075 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPM-C-HA)
PV216076 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPM-C-His)
PV216077 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPB-C-His)
PV216078 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPB-N-His)
PV216079 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPM-C-HA)
PV216080 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPM-C-His)
PV216081 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPB-C-His)
PV216082 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPB-N-His)
PV216083 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPM-C-HA)
PV216084 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPM-C-His)
PV216085 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPB-C-His)
PV216086 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPB-N-His)
PV216087 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPM-C-HA)
PV216088 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPM-C-His)
PV216089 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPB-C-His)
PV216090 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPB-N-His)
PV216091 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPM-C-HA)
PV216092 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPM-C-His)
PV216093 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPB-C-His)
PV216094 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPB-N-His)
PV216095 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPM-C-HA)
PV216096 500 ng
EUR 603
PIGP Protein Vector (Mouse) (pPM-C-His)
PV216097 500 ng
EUR 603
PIGP Protein Vector (Rat) (pPB-C-His)
PV293986 500 ng
EUR 603
PIGP Protein Vector (Rat) (pPB-N-His)
PV293987 500 ng
EUR 603
PIGP Protein Vector (Rat) (pPM-C-HA)
PV293988 500 ng
EUR 603
PIGP Protein Vector (Rat) (pPM-C-His)
PV293989 500 ng
EUR 603
Pigp 3'UTR GFP Stable Cell Line
TU166356 1.0 ml Ask for price
PIGP 3'UTR Luciferase Stable Cell Line
TU017940 1.0 ml
EUR 1521
Pigp 3'UTR Luciferase Stable Cell Line
TU116356 1.0 ml Ask for price
PIGP 3'UTR GFP Stable Cell Line
TU067940 1.0 ml
EUR 1521
Pigp 3'UTR GFP Stable Cell Line
TU266234 1.0 ml Ask for price
Pigp 3'UTR Luciferase Stable Cell Line
TU216234 1.0 ml Ask for price
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PIGP Rabbit Polyclonal Antibody