PIGQ Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

PIGQ Polyclonal Antibody

ABP59913-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PIGQ protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of PIGQ from Human, Mouse. This PIGQ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGQ protein at amino acid sequence of 130-210

PIGQ Polyclonal Antibody

ES9992-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PIGQ from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PIGQ Polyclonal Antibody

ES9992-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PIGQ from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PIGQ Rabbit pAb

A17044-100ul 100 ul
EUR 308

PIGQ Rabbit pAb

A17044-200ul 200 ul
EUR 459

PIGQ Rabbit pAb

A17044-20ul 20 ul
EUR 183

PIGQ Rabbit pAb

A17044-50ul 50 ul
EUR 223

PIGQ Antibody

46128-100ul 100ul
EUR 252

PIGQ Antibody

46128-50ul 50ul
EUR 187

PIGQ Antibody

1-CSB-PA883583LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

PIGQ Antibody

DF9745 200ul
EUR 304
Description: PIGQ Antibody detects endogenous levels of total PIGQ.

PIGQ antibody

70R-6645 50 ug
EUR 467
Description: Rabbit polyclonal PIGQ antibody raised against the N terminal of PIGQ

PIGQ antibody

70R-6647 50 ug
EUR 467
Description: Rabbit polyclonal PIGQ antibody raised against the N terminal of PIGQ

PIGQ Antibody

ABD9745 100 ug
EUR 438

PIGQ Conjugated Antibody

C46128 100ul
EUR 397

Anti-PIGQ antibody

STJ119318 100 µl
EUR 277

Anti-PIGQ antibody

STJ191150 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PIGQ

PIGQ siRNA

20-abx928578
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIGQ siRNA

20-abx928579
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIGQ Antibody, HRP conjugated

1-CSB-PA883583LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PIGQ Antibody, FITC conjugated

1-CSB-PA883583LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PIGQ Antibody, Biotin conjugated

1-CSB-PA883583LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PIGQ Blocking Peptide

33R-9665 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PIGQ antibody, catalog no. 70R-6645

PIGQ Blocking Peptide

33R-7400 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PIGQ antibody, catalog no. 70R-6647

PIGQ Blocking Peptide

DF9745-BP 1mg
EUR 195

PIGQ cloning plasmid

CSB-CL883583HU-10ug 10ug
EUR 749
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2283
  • Sequence: atggtgctcaaggccttcttccccacgtgctgcgtctcgacggacagcgggctgctggtgggacggtgggtgccggagcagagcagcgccgtggtcctggcggtcctgcactttcccttcatccccatccaggtcaagcagctcctggcccaggtgcggcaggccagccaggtgg
  • Show more
Description: A cloning plasmid for the PIGQ gene.

pENTR223-PIGQ vector

PVT11790 2 ug
EUR 304

Anti-PIGQ (2B7)

YF-MA16652 100 ug
EUR 363
Description: Mouse monoclonal to PIGQ

Human PIGQ ELISA KIT

ELI-43655h 96 Tests
EUR 824

Mouse Pigq ELISA KIT

ELI-43656m 96 Tests
EUR 865

Human PIGQ shRNA Plasmid

20-abx956004
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PIGQ shRNA Plasmid

20-abx970628
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PIGQ Recombinant Protein (Human)

RP023476 100 ug Ask for price

PIGQ Recombinant Protein (Mouse)

RP162071 100 ug Ask for price

PIGQ Recombinant Protein (Rat)

RP220490 100 ug Ask for price

Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit Q (PIGQ) Antibody

20-abx217768
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pigq ORF Vector (Rat) (pORF)

ORF073498 1.0 ug DNA
EUR 506

PIGQ ORF Vector (Human) (pORF)

ORF007826 1.0 ug DNA
EUR 95

Pigq ORF Vector (Mouse) (pORF)

ORF054025 1.0 ug DNA
EUR 506

Pigq sgRNA CRISPR Lentivector set (Mouse)

K4911601 3 x 1.0 ug
EUR 339

Pigq sgRNA CRISPR Lentivector set (Rat)

K7371601 3 x 1.0 ug
EUR 339

PIGQ sgRNA CRISPR Lentivector set (Human)

K1648101 3 x 1.0 ug
EUR 339

Pigq sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4911602 1.0 ug DNA
EUR 154

Pigq sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4911603 1.0 ug DNA
EUR 154

Pigq sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4911604 1.0 ug DNA
EUR 154

Pigq sgRNA CRISPR Lentivector (Rat) (Target 1)

K7371602 1.0 ug DNA
EUR 154

Pigq sgRNA CRISPR Lentivector (Rat) (Target 2)

K7371603 1.0 ug DNA
EUR 154

Pigq sgRNA CRISPR Lentivector (Rat) (Target 3)

K7371604 1.0 ug DNA
EUR 154

PIGQ sgRNA CRISPR Lentivector (Human) (Target 1)

K1648102 1.0 ug DNA
EUR 154

PIGQ sgRNA CRISPR Lentivector (Human) (Target 2)

K1648103 1.0 ug DNA
EUR 154

PIGQ sgRNA CRISPR Lentivector (Human) (Target 3)

K1648104 1.0 ug DNA
EUR 154

PIGQ Protein Vector (Rat) (pPB-C-His)

PV293990 500 ng
EUR 603

PIGQ Protein Vector (Rat) (pPB-N-His)

PV293991 500 ng
EUR 603

PIGQ Protein Vector (Rat) (pPM-C-HA)

PV293992 500 ng
EUR 603

PIGQ Protein Vector (Rat) (pPM-C-His)

PV293993 500 ng
EUR 603

PIGQ Protein Vector (Human) (pPB-C-His)

PV031301 500 ng
EUR 329

PIGQ Protein Vector (Human) (pPB-N-His)

PV031302 500 ng
EUR 329

PIGQ Protein Vector (Human) (pPM-C-HA)

PV031303 500 ng
EUR 329

PIGQ Protein Vector (Human) (pPM-C-His)

PV031304 500 ng
EUR 329

PIGQ Protein Vector (Mouse) (pPB-C-His)

PV216098 500 ng
EUR 603

PIGQ Protein Vector (Mouse) (pPB-N-His)

PV216099 500 ng
EUR 603

PIGQ Protein Vector (Mouse) (pPM-C-HA)

PV216100 500 ng
EUR 603

PIGQ Protein Vector (Mouse) (pPM-C-His)

PV216101 500 ng
EUR 603

Pigq 3'UTR Luciferase Stable Cell Line

TU116357 1.0 ml Ask for price

Pigq 3'UTR GFP Stable Cell Line

TU166357 1.0 ml Ask for price

Pigq 3'UTR Luciferase Stable Cell Line

TU216235 1.0 ml Ask for price

Pigq 3'UTR GFP Stable Cell Line

TU266235 1.0 ml Ask for price

PIGQ 3'UTR GFP Stable Cell Line

TU067941 1.0 ml
EUR 1394

PIGQ 3'UTR Luciferase Stable Cell Line

TU017941 1.0 ml
EUR 1394

PIGQ Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV634447 1.0 ug DNA
EUR 682

PIGQ Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV634451 1.0 ug DNA
EUR 682

PIGQ Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV634452 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

PIGQ Rabbit Polyclonal Antibody