PLK4 Rabbit Polyclonal Antibody

Order Now:

PLK4 Polyclonal Antibody

ABP59943-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PLK4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PLK4 from Human, Mouse, Rat. This PLK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLK4 protein

PLK4 Polyclonal Antibody

ABP59943-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PLK4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PLK4 from Human, Mouse, Rat. This PLK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLK4 protein

PLK4 Rabbit pAb

A9863-100ul 100 ul
EUR 308

PLK4 Rabbit pAb

A9863-200ul 200 ul
EUR 459

PLK4 Rabbit pAb

A9863-20ul 20 ul
EUR 183

PLK4 Rabbit pAb

A9863-50ul 50 ul
EUR 223

PLK4 Antibody

ABD8120 100 ug
EUR 438

PLK4 Antibody

43523-100ul 100ul
EUR 252

PLK4 antibody

70R-19350 50 ul
EUR 435
Description: Rabbit polyclonal PLK4 antibody

PLK4 Antibody

DF8120 200ul
EUR 304
Description: PLK4 Antibody detects endogenous levels of total PLK4.

PLK4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PLK4. Recognizes PLK4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal PLK4 Antibody (C-Term)

APR04894G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLK4 (C-Term). This antibody is tested and proven to work in the following applications:

Serine/Threonine-Protein Kinase PLK4 (PLK4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/Threonine-Protein Kinase PLK4 (PLK4) Antibody

abx236550-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Plk4/ Rat Plk4 ELISA Kit

ELI-19658r 96 Tests
EUR 886

PLK4 Conjugated Antibody

C43523 100ul
EUR 397

anti- PLK4 antibody

FNab06550 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: polo-like kinase 4 (Drosophila)
  • Uniprot ID: O00444
  • Gene ID: 10733
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against PLK4

Anti-PLK4 antibody

PAab06550 100 ug
EUR 355

Anti-PLK4 antibody

STJ111905 100 µl
EUR 277
Description: This gene encodes a member of the polo family of serine/threonine protein kinases. The protein localizes to centrioles, complex microtubule-based structures found in centrosomes, and regulates centriole duplication during the cell cycle. Three alternatively spliced transcript variants that encode different protein isoforms have been found for this gene.

Anti-PLK4 antibody

STJ191369 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PLK4


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA17180 50 ug
EUR 363
Description: Mouse polyclonal to PLK4


YF-PA17181 100 ul
EUR 403
Description: Rabbit polyclonal to PLK4

Polyclonal Goat Anti-Sak / STK18 / PLK4 Antibody

APG00293G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-Sak / STK18 / PLK4 . This antibody is tested and proven to work in the following applications:

PLK4 cloning plasmid

CSB-CL018196HU-10ug 10ug
EUR 926
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2913
  • Sequence: atggcgacctgcatcggggagaagatcgaggattttaaagttggaaatctgcttggtaaaggatcatttgctggtgtctacagagctgagtccattcacactggtttggaagttgcaatcaaaatgatagataagaaagccatgtacaaagcaggaatggtacagagagtccaaa
  • Show more
Description: A cloning plasmid for the PLK4 gene.

PLK4 Blocking Peptide

DF8120-BP 1mg
EUR 195

Anti-PLK4 (1C8)

YF-MA11310 100 ug
EUR 363
Description: Mouse monoclonal to PLK4

Anti-Sak / STK18 / PLK4 antibody

STJ70130 100 µg
EUR 359

Human Serine/threonine- protein kinase PLK4, PLK4 ELISA KIT

ELI-23052h 96 Tests
EUR 824

Mouse Serine/threonine- protein kinase PLK4, Plk4 ELISA KIT

ELI-15337m 96 Tests
EUR 865

Bovine Serine/threonine- protein kinase PLK4, PLK4 ELISA KIT

ELI-16326b 96 Tests
EUR 928

Human Serine/Threonine-Protein Kinase PLK4 (PLK4) ELISA Kit

abx382296-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat PLK4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF001865 96 Tests
EUR 689

Human PLK4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PLK4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pECMV- 3*Flag- pLK4

PVT10280 2 ug
EUR 266

Polo Like Kinase 4 (PLK4) Antibody

abx430040-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

PLK4 ORF Vector (Human) (pORF)

ORF007939 1.0 ug DNA
EUR 95

h PLK4 inducible lentiviral particles

LVP226 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, PLK4, is fully sequence verified and matched to NCBI accession ID: NM_014264.3

Plk4 ORF Vector (Rat) (pORF)

ORF073674 1.0 ug DNA
EUR 506

Plk4 ORF Vector (Mouse) (pORF)

ORF054310 1.0 ug DNA
EUR 506

Plk4 ORF Vector (Mouse) (pORF)

ORF054311 1.0 ug DNA
EUR 506

PLK4 sgRNA CRISPR Lentivector set (Human)

K1669401 3 x 1.0 ug
EUR 339

Plk4 sgRNA CRISPR Lentivector set (Mouse)

K3975401 3 x 1.0 ug
EUR 339

Plk4 sgRNA CRISPR Lentivector set (Rat)

K7603601 3 x 1.0 ug
EUR 339

PLK4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1669402 1.0 ug DNA
EUR 154

PLK4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1669403 1.0 ug DNA
EUR 154

PLK4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1669404 1.0 ug DNA
EUR 154

Plk4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3975402 1.0 ug DNA
EUR 154

Plk4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3975403 1.0 ug DNA
EUR 154

Plk4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3975404 1.0 ug DNA
EUR 154

Plk4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7603602 1.0 ug DNA
EUR 154

Plk4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7603603 1.0 ug DNA
EUR 154

Plk4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7603604 1.0 ug DNA
EUR 154

PLK4 Protein Vector (Human) (pPB-C-His)

PV031753 500 ng
EUR 329

PLK4 Protein Vector (Human) (pPB-N-His)

PV031754 500 ng
EUR 329

PLK4 Protein Vector (Human) (pPM-C-HA)

PV031755 500 ng
EUR 329

PLK4 Protein Vector (Human) (pPM-C-His)

PV031756 500 ng
EUR 329

PLK4 Protein Vector (Mouse) (pPB-C-His)

PV217238 500 ng
EUR 1065

PLK4 Protein Vector (Mouse) (pPB-N-His)

PV217239 500 ng
EUR 1065

PLK4 Protein Vector (Mouse) (pPM-C-HA)

PV217240 500 ng
EUR 1065

PLK4 Protein Vector (Mouse) (pPM-C-His)

PV217241 500 ng
EUR 1065

PLK4 Protein Vector (Mouse) (pPB-C-His)

PV217242 500 ng
EUR 1065

PLK4 Protein Vector (Mouse) (pPB-N-His)

PV217243 500 ng
EUR 1065

PLK4 Protein Vector (Mouse) (pPM-C-HA)

PV217244 500 ng
EUR 1065

PLK4 Protein Vector (Mouse) (pPM-C-His)

PV217245 500 ng
EUR 1065

PLK4 Protein Vector (Rat) (pPB-C-His)

PV294694 500 ng
EUR 1166

PLK4 Protein Vector (Rat) (pPB-N-His)

PV294695 500 ng
EUR 1166

PLK4 Protein Vector (Rat) (pPM-C-HA)

PV294696 500 ng
EUR 1166

PLK4 Protein Vector (Rat) (pPM-C-His)

PV294697 500 ng
EUR 1166

Plk4 3'UTR GFP Stable Cell Line

TU166562 1.0 ml Ask for price

PLK4 3'UTR Luciferase Stable Cell Line

TU018280 1.0 ml
EUR 1394

Plk4 3'UTR Luciferase Stable Cell Line

TU116562 1.0 ml Ask for price

PLK4 3'UTR GFP Stable Cell Line

TU068280 1.0 ml
EUR 1394

Plk4 3'UTR GFP Stable Cell Line

TU266419 1.0 ml Ask for price

Plk4 3'UTR Luciferase Stable Cell Line

TU216419 1.0 ml Ask for price

PLK4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV664903 1.0 ug DNA
EUR 1355

PLK4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV664907 1.0 ug DNA
EUR 1355

PLK4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV664908 1.0 ug DNA
EUR 1355

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PLK4 Rabbit Polyclonal Antibody