PNKD Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

PNKD Polyclonal Antibody

ABP59960-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PNKD protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of PNKD from Human, Mouse. This PNKD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PNKD protein at amino acid sequence of 140-220

PNKD Polyclonal Antibody

ES10050-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PNKD from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PNKD Polyclonal Antibody

ES10050-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PNKD from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PNKD Rabbit pAb

A8203-100ul 100 ul
EUR 308

PNKD Rabbit pAb

A8203-200ul 200 ul
EUR 459

PNKD Rabbit pAb

A8203-20ul 20 ul
EUR 183

PNKD Rabbit pAb

A8203-50ul 50 ul
EUR 223

PNKD Polyclonal Conjugated Antibody

C31468 100ul
EUR 397

Probable Hydrolase PNKD (PNKD) Antibody

abx026892-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Probable Hydrolase PNKD (PNKD) Antibody

abx026892-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Probable Hydrolase PNKD (PNKD) Antibody

abx036151-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Probable Hydrolase PNKD (PNKD) Antibody

abx236582-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Probable Hydrolase PNKD (PNKD) Antibody

20-abx318048
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PNKD antibody

70R-19375 50 ul
EUR 435
Description: Rabbit polyclonal PNKD antibody

PNKD Antibody

39834-100ul 100ul
EUR 390

PNKD Antibody

1-CSB-PA843154LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

PNKD Antibody

1-CSB-PA018260GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

PNKD antibody

70R-35856 100 ug
EUR 349
Description: Rabbit polyclonal PNKD antibody

Pnkd antibody

70R-8613 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Pnkd antibody

Probable Hydrolase PNKD (PNKD) Antibody (HRP)

20-abx315475
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Probable Hydrolase PNKD (PNKD) Antibody (FITC)

20-abx315476
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Probable Hydrolase PNKD (PNKD) Antibody (Biotin)

20-abx315477
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

anti- PNKD antibody

FNab06582 100µg
EUR 505.25
  • Immunogen: paroxysmal nonkinesigenic dyskinesia
  • Uniprot ID: Q8N490
  • Gene ID: 25953
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against PNKD

Anti-PNKD antibody

PAab06582 100 ug
EUR 355

Anti-PNKD antibody

STJ117854 100 µl
EUR 277
Description: This gene is thought to play a role in the regulation of myofibrillogenesis. Mutations in this gene have been associated with the movement disorder paroxysmal non-kinesigenic dyskinesia. Alternative splicing results in multiple transcript variants.

Anti-PNKD antibody

STJ191208 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PNKD

PNKD siRNA

20-abx929060
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PNKD siRNA

20-abx929061
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PNKD

YF-PA27528 50 ug
EUR 363
Description: Mouse polyclonal to PNKD

PNKD Antibody, HRP conjugated

1-CSB-PA843154LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PNKD Antibody, FITC conjugated

1-CSB-PA843154LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PNKD Antibody, Biotin conjugated

1-CSB-PA843154LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Bovine Probable hydrolase PNKD, PNKD ELISA KIT

ELI-43539b 96 Tests
EUR 928

Mouse Probable hydrolase PNKD, Pnkd ELISA KIT

ELI-43540m 96 Tests
EUR 865

Human Probable hydrolase PNKD (PNKD) ELISA Kit

abx382321-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Probable hydrolase PNKD (PNKD) ELISA Kit

abx390160-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Probable hydrolase PNKD, PNKD ELISA KIT

ELI-36132h 96 Tests
EUR 824

Pnkd Blocking Peptide

33R-5615 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Pnkd antibody, catalog no. 70R-8613

PNKD cloning plasmid

CSB-CL843154HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1086
  • Sequence: atggcttggcagggctggcccgcggcgtggcagtgggtcgccggctgctggctcctcctcgtccttgtcctcgtcctacttgtgagcccccgcggctgccgagcgcggcggggcctccgcggtctgctcatggcgcacagccagcggctgctcttccgaatcgggtacagcctgt
  • Show more
Description: A cloning plasmid for the PNKD gene.

PNKD cloning plasmid

CSB-CL843154HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1158
  • Sequence: atggcggcggtggtagctgctacggcgctgaagagccggggggcgagaaatgcccgcgtcctccgggggattctcgcaggagccacagctaacaaggtttctcataacaggacccgggccctgcaaagccacagctcctcagagggcaaggaggaacctgaacccctatccccgg
  • Show more
Description: A cloning plasmid for the PNKD gene.

PNKD cloning plasmid

CSB-CL843154HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 429
  • Sequence: atggcggcggtggtagctgctacggcgctgaagggccggggggcgagaaatgcccgcgtcctccgggggattctcgcaggagccacagctaacaaggcttctcataacaggacccgggccctgcaaagccacagctccccagagggcaaggaggaacctgaacccctatccccgga
  • Show more
Description: A cloning plasmid for the PNKD gene.

Pnkd ELISA Kit| Mouse Probable hydrolase PNKD ELISA Kit

EF015799 96 Tests
EUR 689

PNKD ELISA Kit| Bovine Probable hydrolase PNKD ELISA Kit

EF011715 96 Tests
EUR 689

PNKD ELISA KIT|Human

EF001893 96 Tests
EUR 689

Mouse PNKD shRNA Plasmid

20-abx974862
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PNKD shRNA Plasmid

20-abx958613
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PNKD Recombinant Protein (Human)

RP023923 100 ug Ask for price

PNKD Recombinant Protein (Human)

RP023926 100 ug Ask for price

PNKD Recombinant Protein (Human)

RP023929 100 ug Ask for price

PNKD Recombinant Protein (Mouse)

RP163112 100 ug Ask for price

PNKD Recombinant Protein (Mouse)

RP163115 100 ug Ask for price

PNKD Recombinant Protein (Mouse)

RP163118 100 ug Ask for price

PNKD Recombinant Protein (Rat)

RP221156 100 ug Ask for price

PNKD Recombinant Protein (Rat)

RP221159 100 ug Ask for price

PNKD Recombinant Protein (Rat)

RP221162 100 ug Ask for price

Pnkd ORF Vector (Rat) (pORF)

ORF073720 1.0 ug DNA
EUR 506

Pnkd ORF Vector (Rat) (pORF)

ORF073721 1.0 ug DNA
EUR 506

Pnkd ORF Vector (Rat) (pORF)

ORF073722 1.0 ug DNA
EUR 506

PNKD ORF Vector (Human) (pORF)

ORF007975 1.0 ug DNA
EUR 95

PNKD ORF Vector (Human) (pORF)

ORF007976 1.0 ug DNA
EUR 95

PNKD ORF Vector (Human) (pORF)

ORF007977 1.0 ug DNA
EUR 95

Pnkd ORF Vector (Mouse) (pORF)

ORF054372 1.0 ug DNA
EUR 506

Pnkd ORF Vector (Mouse) (pORF)

ORF054373 1.0 ug DNA
EUR 506

Pnkd ORF Vector (Mouse) (pORF)

ORF054374 1.0 ug DNA
EUR 506

Pnkd sgRNA CRISPR Lentivector set (Mouse)

K4860101 3 x 1.0 ug
EUR 339

Pnkd sgRNA CRISPR Lentivector set (Rat)

K7520901 3 x 1.0 ug
EUR 339

PNKD sgRNA CRISPR Lentivector set (Human)

K1675901 3 x 1.0 ug
EUR 339

Pnkd sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4860102 1.0 ug DNA
EUR 154

Pnkd sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4860103 1.0 ug DNA
EUR 154

Pnkd sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4860104 1.0 ug DNA
EUR 154

Pnkd sgRNA CRISPR Lentivector (Rat) (Target 1)

K7520902 1.0 ug DNA
EUR 154

Pnkd sgRNA CRISPR Lentivector (Rat) (Target 2)

K7520903 1.0 ug DNA
EUR 154

Pnkd sgRNA CRISPR Lentivector (Rat) (Target 3)

K7520904 1.0 ug DNA
EUR 154

PNKD sgRNA CRISPR Lentivector (Human) (Target 1)

K1675902 1.0 ug DNA
EUR 154

PNKD sgRNA CRISPR Lentivector (Human) (Target 2)

K1675903 1.0 ug DNA
EUR 154

PNKD sgRNA CRISPR Lentivector (Human) (Target 3)

K1675904 1.0 ug DNA
EUR 154

PNKD Protein Vector (Rat) (pPB-C-His)

PV294878 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPB-N-His)

PV294879 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPM-C-HA)

PV294880 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPM-C-His)

PV294881 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPB-C-His)

PV294882 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPB-N-His)

PV294883 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPM-C-HA)

PV294884 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPM-C-His)

PV294885 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPB-C-His)

PV294886 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPB-N-His)

PV294887 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPM-C-HA)

PV294888 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPM-C-His)

PV294889 500 ng
EUR 603

PNKD Protein Vector (Human) (pPB-C-His)

PV031897 500 ng
EUR 329

PNKD Protein Vector (Human) (pPB-N-His)

PV031898 500 ng
EUR 329

PNKD Protein Vector (Human) (pPM-C-HA)

PV031899 500 ng
EUR 329

PNKD Protein Vector (Human) (pPM-C-His)

PV031900 500 ng
EUR 329

PNKD Protein Vector (Human) (pPB-C-His)

PV031901 500 ng
EUR 329

PNKD Protein Vector (Human) (pPB-N-His)

PV031902 500 ng
EUR 329

PNKD Protein Vector (Human) (pPM-C-HA)

PV031903 500 ng
EUR 329

PNKD Protein Vector (Human) (pPM-C-His)

PV031904 500 ng
EUR 329

PNKD Protein Vector (Human) (pPB-C-His)

PV031905 500 ng
EUR 329

PNKD Protein Vector (Human) (pPB-N-His)

PV031906 500 ng
EUR 329

PNKD Protein Vector (Human) (pPM-C-HA)

PV031907 500 ng
EUR 329

PNKD Protein Vector (Human) (pPM-C-His)

PV031908 500 ng
EUR 329

PNKD Protein Vector (Mouse) (pPB-C-His)

PV217486 500 ng
EUR 1065

PNKD Protein Vector (Mouse) (pPB-N-His)

PV217487 500 ng
EUR 1065

PNKD Protein Vector (Mouse) (pPM-C-HA)

PV217488 500 ng
EUR 1065

PNKD Protein Vector (Mouse) (pPM-C-His)

PV217489 500 ng
EUR 1065

PNKD Protein Vector (Mouse) (pPB-C-His)

PV217490 500 ng
EUR 603

PNKD Protein Vector (Mouse) (pPB-N-His)

PV217491 500 ng
EUR 603

PNKD Protein Vector (Mouse) (pPM-C-HA)

PV217492 500 ng
EUR 603

PNKD Protein Vector (Mouse) (pPM-C-His)

PV217493 500 ng
EUR 603

PNKD Protein Vector (Mouse) (pPB-C-His)

PV217494 500 ng
EUR 1065

PNKD Protein Vector (Mouse) (pPB-N-His)

PV217495 500 ng
EUR 1065

PNKD Protein Vector (Mouse) (pPM-C-HA)

PV217496 500 ng
EUR 1065

PNKD Protein Vector (Mouse) (pPM-C-His)

PV217497 500 ng
EUR 1065

Pnkd 3'UTR Luciferase Stable Cell Line

TU116611 1.0 ml Ask for price

Pnkd 3'UTR GFP Stable Cell Line

TU166611 1.0 ml Ask for price

Pnkd 3'UTR Luciferase Stable Cell Line

TU216465 1.0 ml Ask for price

Pnkd 3'UTR GFP Stable Cell Line

TU266465 1.0 ml Ask for price

PNKD 3'UTR GFP Stable Cell Line

TU068346 1.0 ml
EUR 1521

PNKD 3'UTR Luciferase Stable Cell Line

TU018346 1.0 ml
EUR 1521

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

PNKD Rabbit Polyclonal Antibody