PPIG Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

PPIG Polyclonal Antibody
ABP59982-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PPIG protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of PPIG from Human, Mouse, Rat. This PPIG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PPIG protein at amino acid sequence of 290-370
PPIG Polyclonal Antibody
ABP59982-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PPIG protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of PPIG from Human, Mouse, Rat. This PPIG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PPIG protein at amino acid sequence of 290-370
PPIG Polyclonal Antibody
ES9975-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PPIG from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
PPIG Polyclonal Antibody
ES9975-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PPIG from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
PPIG Rabbit pAb
A0429-100ul 100 ul
EUR 308
PPIG Rabbit pAb
A0429-200ul 200 ul
EUR 459
PPIG Rabbit pAb
A0429-20ul 20 ul
EUR 183
PPIG Rabbit pAb
A0429-50ul 50 ul
EUR 223
PPIG antibody
70R-19450 50 ul
EUR 435
Description: Rabbit polyclonal PPIG antibody
PPIG Antibody
43878-100ul 100ul
EUR 252
PPIG Antibody
AF4766 200ul
EUR 376
Description: PPIG Antibody detects endogenous levels of PPIG.
PPIG Antibody
1-CSB-PA018477GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PPIG. Recognizes PPIG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
Polyclonal PPIG Antibody (internal region)
AMM07280G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PPIG (internal region). This antibody is tested and proven to work in the following applications:
Phospho-PPIG-S376 Rabbit pAb
AP0842-100ul 100 ul
EUR 384
Phospho-PPIG-S376 Rabbit pAb
AP0842-200ul 200 ul
EUR 554
Phospho-PPIG-S376 Rabbit pAb
AP0842-20ul 20 ul
EUR 183
Phospho-PPIG-S376 Rabbit pAb
AP0842-50ul 50 ul
EUR 265
PPIG Conjugated Antibody
C43878 100ul
EUR 397
anti- PPIG antibody
FNab06677 100µg
EUR 548.75
  • Immunogen: peptidylprolyl isomerase G(cyclophilin G)
  • Uniprot ID: Q13427
  • Gene ID: 9360
  • Research Area: Metabolism
Description: Antibody raised against PPIG
Anti-PPIG Antibody
PA2152 100ug/vial
EUR 294
Anti-PPIG antibody
PAab06677 100 ug
EUR 386
Anti-PPIG antibody
STJ114882 100 µl
EUR 277
Anti-PPIG antibody
STJ72047 100 µg
EUR 359
Anti-PPIG antibody
STJ191133 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PPIG
PPIG siRNA
20-abx904162
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PPIG siRNA
20-abx929406
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PPIG siRNA
20-abx929407
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-PPIG
YF-PA16240 50 ul
EUR 363
Description: Mouse polyclonal to PPIG
anti-PPIG
YF-PA16241 100 ul
EUR 403
Description: Rabbit polyclonal to PPIG
anti-PPIG
YF-PA25318 50 ul
EUR 334
Description: Mouse polyclonal to PPIG
Phospho-PPIG (Ser376) Antibody
AF4466 200ul
EUR 376
Description: Phospho-PPIG (Ser376) Antibody detects endogenous levels of PPIG only when phosphorylated at Ser376.
Phospho- PPIG (Ser376) Antibody
ABF3708 100 ug
EUR 438
PPIG Blocking Peptide
AF4766-BP 1mg
EUR 195
PPIG cloning plasmid
CSB-CL615686HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1074
  • Sequence: atgggaataaaggttcaacgtcctcgatgtttttttgacattgccattaacaatcaacctgctggaagagttgtctttgaattattttctgatgtgtgccccaaaacatgcgagaactttcgttgtctttgtacaggtgaaaaggggaccgggaaatcaactcagaaaccattac
  • Show more
Description: A cloning plasmid for the PPIG gene.
PPIG cloning plasmid
CSB-CL615686HU2-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2220
  • Sequence: ATGGGAATAAAGGTTCAACGTCCTCGATGTTTTTTTGACATTGCCATTAACAATCAACCTGCTGGAAGAGTTGTCTTTGAATTATTTTCTGATGTGTGCCCCAAAACATGCGAGAACTTTCGTTGTCTTTGTACAGGTGAAAAGGGGACCGGGAAATCAACTCAGAAACCATTAC
  • Show more
Description: A cloning plasmid for the PPIG gene.
pCMV-SPORT6-PPIG
PVT13862 2 ug
EUR 391
Anti-PPIG (4F8)
YF-MA11167 100 ug
EUR 363
Description: Mouse monoclonal to PPIG
Anti-PPIG (4F7)
YF-MA16800 100 ug
EUR 363
Description: Mouse monoclonal to PPIG
Human Cyclophilin G (PPIG) Antibody
30027-05111 150 ug
EUR 261
Peptidylprolyl Isomerase G (PPIG) Antibody
abx236677-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Peptidylprolyl Isomerase G (PPIG) Antibody
abx431741-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Peptidylprolyl Isomerase G (PPIG) Antibody
20-abx000715
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Anti-Phospho-PPIG-S376 antibody
STJ11100983 100 µl
EUR 393
PPIG ELISA KIT|Human
EF001975 96 Tests
EUR 689
Rat PPIG shRNA Plasmid
20-abx986822
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human PPIG shRNA Plasmid
20-abx956196
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse PPIG shRNA Plasmid
20-abx981607
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PPIG Recombinant Protein (Human)
RP024277 100 ug Ask for price
PPIG Recombinant Protein (Human)
RP042397 100 ug Ask for price
PPIG Recombinant Protein (Mouse)
RP163739 100 ug Ask for price
PPIG Recombinant Protein (Rat)
RP221624 100 ug Ask for price
Human Cyclophilin G (PPIG) Antibody (Biotin Conjugate)
30027-05121 150 ug
EUR 369
Monoclonal PPIG Antibody (monoclonal) (M02), Clone: 4F8
AMM07281G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PPIG (monoclonal) (M02). The antibodies are raised in mouse and are from clone 4F8. This antibody is applicable in WB, IHC and IF, E
Phospho-PPIG (Ser376) Blocking Peptide
AF4466-BP 1mg
EUR 195
Ppig ORF Vector (Rat) (pORF)
ORF073876 1.0 ug DNA
EUR 506
PPIG ORF Vector (Human) (pORF)
ORF014133 1.0 ug DNA
EUR 354
PPIG ORF Vector (Human) (pORF)
ORF008093 1.0 ug DNA
EUR 95
Ppig ORF Vector (Mouse) (pORF)
ORF054581 1.0 ug DNA
EUR 506
Human Cyclophilin G (PPIG) AssayLite Antibody (FITC Conjugate)
30027-05141 150 ug
EUR 428
Human Cyclophilin G (PPIG) AssayLite Antibody (RPE Conjugate)
30027-05151 150 ug
EUR 428
Human Cyclophilin G (PPIG) AssayLite Antibody (APC Conjugate)
30027-05161 150 ug
EUR 428
Human Cyclophilin G (PPIG) AssayLite Antibody (PerCP Conjugate)
30027-05171 150 ug
EUR 471
Ppig sgRNA CRISPR Lentivector set (Mouse)
K4914901 3 x 1.0 ug
EUR 339
Ppig sgRNA CRISPR Lentivector set (Rat)
K6975001 3 x 1.0 ug
EUR 339
PPIG sgRNA CRISPR Lentivector set (Human)
K1699101 3 x 1.0 ug
EUR 339
Human Peptidylprolyl Isomerase G (PPIG) ELISA Kit
abx382392-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Ppig sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4914902 1.0 ug DNA
EUR 154
Ppig sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4914903 1.0 ug DNA
EUR 154
Ppig sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4914904 1.0 ug DNA
EUR 154
Human Cyclophilin G (PPIG) AssayMax ELISA Kit
EP6520-1 96 Well Plate
EUR 477
Ppig sgRNA CRISPR Lentivector (Rat) (Target 1)
K6975002 1.0 ug DNA
EUR 154
Ppig sgRNA CRISPR Lentivector (Rat) (Target 2)
K6975003 1.0 ug DNA
EUR 154
Ppig sgRNA CRISPR Lentivector (Rat) (Target 3)
K6975004 1.0 ug DNA
EUR 154
PPIG sgRNA CRISPR Lentivector (Human) (Target 1)
K1699102 1.0 ug DNA
EUR 154
PPIG sgRNA CRISPR Lentivector (Human) (Target 2)
K1699103 1.0 ug DNA
EUR 154
PPIG sgRNA CRISPR Lentivector (Human) (Target 3)
K1699104 1.0 ug DNA
EUR 154
PPIG Protein Vector (Rat) (pPB-C-His)
PV295502 500 ng
EUR 1166
PPIG Protein Vector (Rat) (pPB-N-His)
PV295503 500 ng
EUR 1166
PPIG Protein Vector (Rat) (pPM-C-HA)
PV295504 500 ng
EUR 1166
PPIG Protein Vector (Rat) (pPM-C-His)
PV295505 500 ng
EUR 1166
PPIG Protein Vector (Human) (pPB-C-His)
PV032369 500 ng
EUR 329
PPIG Protein Vector (Human) (pPB-N-His)
PV032370 500 ng
EUR 329
PPIG Protein Vector (Human) (pPM-C-HA)
PV032371 500 ng
EUR 329
PPIG Protein Vector (Human) (pPM-C-His)
PV032372 500 ng
EUR 329
PPIG Protein Vector (Human) (pPB-C-His)
PV056529 500 ng
EUR 481
PPIG Protein Vector (Human) (pPB-N-His)
PV056530 500 ng
EUR 481
PPIG Protein Vector (Human) (pPM-C-HA)
PV056531 500 ng
EUR 481
PPIG Protein Vector (Human) (pPM-C-His)
PV056532 500 ng
EUR 481
PPIG Protein Vector (Mouse) (pPB-C-His)
PV218322 500 ng
EUR 1065
PPIG Protein Vector (Mouse) (pPB-N-His)
PV218323 500 ng
EUR 1065
PPIG Protein Vector (Mouse) (pPM-C-HA)
PV218324 500 ng
EUR 1065
PPIG Protein Vector (Mouse) (pPM-C-His)
PV218325 500 ng
EUR 1065
Ppig 3'UTR Luciferase Stable Cell Line
TU116776 1.0 ml Ask for price
Ppig 3'UTR GFP Stable Cell Line
TU166776 1.0 ml Ask for price
Ppig 3'UTR Luciferase Stable Cell Line
TU216624 1.0 ml Ask for price

PPIG Rabbit Polyclonal Antibody