PPME1 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

PPME1 Polyclonal Antibody

A50424 100 µg
EUR 570.55
Description: Ask the seller for details

PPME1 Polyclonal Antibody

ABP59987-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PPME1 protein at amino acid sequence of 220-300
  • Applications tips:
Description: A polyclonal antibody for detection of PPME1 from Human, Mouse, Rat. This PPME1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PPME1 protein at amino acid sequence of 220-300

PPME1 Polyclonal Antibody

ABP59987-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PPME1 protein at amino acid sequence of 220-300
  • Applications tips:
Description: A polyclonal antibody for detection of PPME1 from Human, Mouse, Rat. This PPME1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PPME1 protein at amino acid sequence of 220-300

PPME1 Polyclonal Antibody

ABP59987-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PPME1 protein at amino acid sequence of 220-300
  • Applications tips:
Description: A polyclonal antibody for detection of PPME1 from Human, Mouse, Rat. This PPME1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PPME1 protein at amino acid sequence of 220-300

PPME1 Polyclonal Antibody

ES10061-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PPME1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PPME1 Polyclonal Antibody

ES10061-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PPME1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PPME1 Rabbit pAb

A13094-100ul 100 ul
EUR 308

PPME1 Rabbit pAb

A13094-200ul 200 ul
EUR 459

PPME1 Rabbit pAb

A13094-20ul 20 ul
EUR 183

PPME1 Rabbit pAb

A13094-50ul 50 ul
EUR 223

PPME1 Polyclonal Conjugated Antibody

C27895 100ul
EUR 397

PPME1 antibody

70R-19465 50 ul
EUR 435
Description: Rabbit polyclonal PPME1 antibody

PPME1 antibody

10R-5387 100 ul
EUR 691
Description: Mouse monoclonal PPME1 antibody

PPME1 antibody

10R-5388 100 ul
EUR 691
Description: Mouse monoclonal PPME1 antibody

PPME1 antibody

10R-5389 100 ul
EUR 691
Description: Mouse monoclonal PPME1 antibody

PPME1 antibody

70R-3708 50 ug
EUR 467
Description: Rabbit polyclonal PPME1 antibody raised against the N terminal of PPME1

PPME1 antibody

70R-3709 50 ug
EUR 467
Description: Rabbit polyclonal PPME1 antibody raised against the N terminal of PPME1

PPME1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PPME1. Recognizes PPME1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PPME1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPME1. Recognizes PPME1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

Polyclonal PPME1 Antibody (C-term)

AMM07292G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PPME1 (C-term). This antibody is tested and proven to work in the following applications:

PPME1 Polyclonal Antibody, HRP Conjugated

A50425 100 µg
EUR 570.55
Description: The best epigenetics products

PPME1 Polyclonal Antibody, FITC Conjugated

A50426 100 µg
EUR 570.55
Description: kits suitable for this type of research

PPME1 Polyclonal Antibody, Biotin Conjugated

A50427 100 µg
EUR 570.55
Description: fast delivery possible

Human PPME1 Antibody

32213-05111 150 ug
EUR 261

anti- PPME1 antibody

FNab06692 100µg
EUR 548.75
  • Immunogen: protein phosphatase methylesterase 1
  • Uniprot ID: Q9Y570
  • Gene ID: 51400
  • Research Area: Metabolism
Description: Antibody raised against PPME1

Anti-PPME1 antibody

PAab06692 100 ug
EUR 386

Anti-PPME1 antibody

STJ115061 100 µl
EUR 277
Description: This gene encodes a protein phosphatase methylesterase localized to the nucleus. The encoded protein acts on the protein phosphatase-2A catalytic subunit and supports the ERK pathway through dephosphorylation of regulatory proteins. It plays a role in malignant glioma progression. Alternative splicing results in multiple transcript variants.

Anti-PPME1 antibody

STJ191219 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PPME1

Ppme1/ Rat Ppme1 ELISA Kit

ELI-45447r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA19030 50 ul
EUR 363
Description: Mouse polyclonal to PPME1


YF-PA19031 50 ug
EUR 363
Description: Mouse polyclonal to PPME1

PPME1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPME1. Recognizes PPME1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PPME1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPME1. Recognizes PPME1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PPME1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPME1. Recognizes PPME1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PPME1 Blocking Peptide

33R-6394 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPME1 antibody, catalog no. 70R-3708

PPME1 Blocking Peptide

33R-7126 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPME1 antibody, catalog no. 70R-3709

PPME1 Protein (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

PPME1 cloning plasmid

CSB-CL018501HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1161
  • Sequence: atgtcggccctcgaaaagagcatgcacctcggccgccttccctctcgcccacctctacccggcagcgggggcagtcagagcggagccaagatgcgaatgggccctggaagaaagcgggacttttcccctgttccttggagtcagtattttgagtccatggaagatgtagaagtag
  • Show more
Description: A cloning plasmid for the PPME1 gene.

pENTR223-PPME1 vector

PVT12037 2 ug
EUR 308

Human PPME1 Antibody (Biotin Conjugate)

32213-05121 150 ug
EUR 369

Human PPME1 AssayLite Antibody (FITC Conjugate)

32213-05141 150 ug
EUR 428

Human PPME1 AssayLite Antibody (RPE Conjugate)

32213-05151 150 ug
EUR 428

Human PPME1 AssayLite Antibody (APC Conjugate)

32213-05161 150 ug
EUR 428

Human PPME1 AssayLite Antibody (PerCP Conjugate)

32213-05171 150 ug
EUR 471

Protein Phosphatase Methylesterase 1 (PPME1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Phosphatase Methylesterase 1 (PPME1) Antibody

abx048500-100ug 100 ug
EUR 481
  • Shipped within 5-10 working days.

Protein Phosphatase Methylesterase 1 (PPME1) Antibody

  • EUR 98.00
  • EUR 133.00
  • EUR 523.00
  • 10 ul
  • 20 ul
  • 400 ul
  • Shipped within 5-10 working days.

Protein Phosphatase Methylesterase 1 (PPME1) Antibody

abx029420-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Protein Phosphatase Methylesterase 1 (PPME1) Antibody

abx236692-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Protein Phosphatase Methylesterase 1 (PPME1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PPME1 protein (His tag)

80R-1904 100 ug
EUR 305
Description: Purified recombinant PPME1 protein


EF005466 96 Tests
EUR 689

Rat PPME1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PPME1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PPME1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


PVT12662 2 ug
EUR 703

PPME1 Recombinant Protein (Human)

RP024325 100 ug Ask for price

PPME1 Recombinant Protein (Mouse)

RP163835 100 ug Ask for price

PPME1 Recombinant Protein (Rat)

RP221675 100 ug Ask for price

Protein Phosphatase Methylesterase 1 (PPME1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Phosphatase Methylesterase 1 (PPME1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Phosphatase Methylesterase 1 (PPME1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ppme1 ORF Vector (Rat) (pORF)

ORF073893 1.0 ug DNA
EUR 506

PPME1 ORF Vector (Human) (pORF)

ORF008109 1.0 ug DNA
EUR 95

Ppme1 ORF Vector (Mouse) (pORF)

ORF054613 1.0 ug DNA
EUR 506

PPME1 ELISA Kit (Rat) (OKEH03629)

OKEH03629 96 Wells
EUR 779
Description: Description of target: Demethylates proteins that have been reversibly carboxymethylated. Demethylates PPP2CB (in vitro) and PPP2CA. Binding to PPP2CA displaces the manganese ion and inactivates the enzyme.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.325 ng/mL

Ppme1 sgRNA CRISPR Lentivector set (Rat)

K6404301 3 x 1.0 ug
EUR 339

Ppme1 sgRNA CRISPR Lentivector set (Mouse)

K3733801 3 x 1.0 ug
EUR 339

PPME1 sgRNA CRISPR Lentivector set (Human)

K1701501 3 x 1.0 ug
EUR 339

Ppme1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6404302 1.0 ug DNA
EUR 154

Ppme1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6404303 1.0 ug DNA
EUR 154

Ppme1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6404304 1.0 ug DNA
EUR 154

Ppme1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3733802 1.0 ug DNA
EUR 154

Ppme1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3733803 1.0 ug DNA
EUR 154

Ppme1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3733804 1.0 ug DNA
EUR 154

PPME1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1701502 1.0 ug DNA
EUR 154

PPME1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1701503 1.0 ug DNA
EUR 154

PPME1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1701504 1.0 ug DNA
EUR 154

PPME1 Protein Vector (Rat) (pPB-C-His)

PV295570 500 ng
EUR 603

PPME1 Protein Vector (Rat) (pPB-N-His)

PV295571 500 ng
EUR 603

PPME1 Protein Vector (Rat) (pPM-C-HA)

PV295572 500 ng
EUR 603

PPME1 Protein Vector (Rat) (pPM-C-His)

PV295573 500 ng
EUR 603

PPME1 Protein Vector (Human) (pPB-C-His)

PV032433 500 ng
EUR 329

PPME1 Protein Vector (Human) (pPB-N-His)

PV032434 500 ng
EUR 329

PPME1 Protein Vector (Human) (pPM-C-HA)

PV032435 500 ng
EUR 329

PPME1 Protein Vector (Human) (pPM-C-His)

PV032436 500 ng
EUR 329

PPME1 Protein Vector (Mouse) (pPB-C-His)

PV218450 500 ng
EUR 603

PPME1 Protein Vector (Mouse) (pPB-N-His)

PV218451 500 ng
EUR 603

PPME1 Protein Vector (Mouse) (pPM-C-HA)

PV218452 500 ng
EUR 603

PPME1 Protein Vector (Mouse) (pPM-C-His)

PV218453 500 ng
EUR 603

Recombinant Human PPME1 Protein, His, E.coli-1mg

QP13121-1mg 1mg
EUR 2757

Recombinant Human PPME1 Protein, His, E.coli-20ug

QP13121-20ug 20ug
EUR 201

Recombinant Human PPME1 Protein, His, E.coli-5ug

QP13121-5ug 5ug
EUR 155

Ppme1 3'UTR Luciferase Stable Cell Line

TU116797 1.0 ml Ask for price

Ppme1 3'UTR GFP Stable Cell Line

TU166797 1.0 ml Ask for price

Ppme1 3'UTR Luciferase Stable Cell Line

TU216642 1.0 ml Ask for price

Ppme1 3'UTR GFP Stable Cell Line

TU266642 1.0 ml Ask for price

PPME1 3'UTR GFP Stable Cell Line

TU068616 1.0 ml
EUR 1394

PPME1 3'UTR Luciferase Stable Cell Line

TU018616 1.0 ml
EUR 1394

Rat Protein phosphatase methylesterase 1 (PPME1) ELISA Kit

abx256482-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Ppme1/ Protein phosphatase methylesterase 1 ELISA Kit

E0785Ra 1 Kit
EUR 646

Mouse Ppme1/ Protein phosphatase methylesterase 1 ELISA Kit

E1180Mo 1 Kit
EUR 632

Human PPME1/ Protein phosphatase methylesterase 1 ELISA Kit

E2010Hu 1 Kit
EUR 605

Bovine Protein phosphatase methylesterase 1, PPME1 ELISA KIT

ELI-45446b 96 Tests
EUR 928

Cow Protein phosphatase methylesterase 1 (PPME1) ELISA Kit

abx516396-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Protein phosphatase methylesterase 1 (PPME1) ELISA Kit

abx516397-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Protein phosphatase methylesterase 1 (PPME1) ELISA Kit

abx516398-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Ppme1(Protein phosphatase methylesterase 1) ELISA Kit

ER0505 96T
EUR 567.6
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: Q4FZT2
  • Alias: Ppme1
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rattus;Sensitivity: 0.375 ng/ml

Human Protein phosphatase methylesterase 1, PPME1 ELISA KIT

ELI-36196h 96 Tests
EUR 824

Mouse Protein phosphatase methylesterase 1, Ppme1 ELISA KIT

ELI-36547m 96 Tests
EUR 865

PPME1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV700207 1.0 ug DNA
EUR 682

PPME1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV700211 1.0 ug DNA
EUR 682

PPME1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV700212 1.0 ug DNA
EUR 682

PPME1 Protein Phosphatase Methylesterase 1 Human Recombinant Protein

PROTQ9Y570 Regular: 20ug
EUR 317
Description: PPME1 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 406 amino acids (1-386) and having a molecular mass of 44.4 kDa.;The PPME1 is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody

ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

PPME1 Rabbit Polyclonal Antibody