PSPC1 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

PSPC1 Polyclonal Antibody

ABP60022-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PSPC1 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of PSPC1 from Human. This PSPC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PSPC1 protein at amino acid sequence of 10-90

PSPC1 Polyclonal Antibody

ABP60022-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PSPC1 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of PSPC1 from Human. This PSPC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PSPC1 protein at amino acid sequence of 10-90

PSPC1 Rabbit pAb

A9209-100ul 100 ul
EUR 308

PSPC1 Rabbit pAb

A9209-200ul 200 ul
EUR 459

PSPC1 Rabbit pAb

A9209-20ul 20 ul
EUR 183

PSPC1 Rabbit pAb

A9209-50ul 50 ul
EUR 223

PSPC1 Antibody

ABD2220 100 ug
EUR 438

PSPC1 Antibody

44675-100ul 100ul
EUR 252

PSPC1 Antibody

44675-50ul 50ul
EUR 187

PSPC1 Antibody

DF2220 200ul
EUR 304
Description: PSPC1 antibody detects endogenous levels of total PSPC1.

PSPC1 Antibody

1-CSB-PA018937LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSPC1. Recognizes PSPC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Pspc1/ Rat Pspc1 ELISA Kit

ELI-43074r 96 Tests
EUR 886

PSPC1 Conjugated Antibody

C44675 100ul
EUR 397

anti- PSPC1 antibody

FNab06901 100µg
EUR 505.25
  • Immunogen: paraspeckle component 1
  • Uniprot ID: Q8WXF1
  • Gene ID: 55269
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against PSPC1

Anti-PSPC1 antibody

PAab06901 100 ug
EUR 355

Anti-PSPC1 antibody

STJ116347 100 µl
EUR 277
Description: This gene encodes a nucleolar protein that localizes to punctate subnuclear structures that occur close to splicing speckles, known as paraspeckles. These paraspeckles are composed of RNA-protein structures that include a non-coding RNA, NEAT1/Men epsilon/beta, and the Drosophila Behavior Human Splicing family of proteins, which include the product of this gene and the P54NRB/NONO and PSF/SFPQ proteins. Paraspeckles may function in the control of gene expression via an RNA nuclear retention mechanism. The protein encoded by this gene is found in paraspeckles in transcriptionally active cells, but it localizes to unique cap structures at the nucleolar periphery when RNA polymerase II transcription is inhibited, or during telophase. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene, which is also located on chromosome 13, has been identified.

Anti-PSPC1 antibody

STJ191131 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PSPC1

PSPC1 siRNA

20-abx904331
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSPC1 siRNA

20-abx930223
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSPC1 siRNA

20-abx930224
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSPC1 Antibody, HRP conjugated

1-CSB-PA018937LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSPC1. Recognizes PSPC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSPC1 Antibody, FITC conjugated

1-CSB-PA018937LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSPC1. Recognizes PSPC1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSPC1 Antibody, Biotin conjugated

1-CSB-PA018937LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSPC1. Recognizes PSPC1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PSPC1 cloning plasmid

CSB-CL018937HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1182
  • Sequence: atgatgttaagaggaaacctgaagcaagtgcgcattgagaaaaacccggcccgccttcgcgccctggagtccgcggtgggcgagagcgagccggcggccgcggcagccatggcgctcgctcttgccggggagccggcaccgcccgcgcccgcgcctccagaggaccacccggacg
  • Show more
Description: A cloning plasmid for the PSPC1 gene.

PSPC1 Blocking Peptide

DF2220-BP 1mg
EUR 195

Paraspeckle Component 1 (PSPC1) Antibody

20-abx124686
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Paraspeckle Component 1 (PSPC1) Antibody

abx122059-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Paraspeckle Component 1 (PSPC1) Antibody

20-abx217640
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Paraspeckle Component 1 (PSPC1) Antibody

abx236901-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Mouse PSPC1 shRNA Plasmid

20-abx975719
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PSPC1 shRNA Plasmid

20-abx989361
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSPC1 ELISA KIT|Human

EF002145 96 Tests
EUR 689

Human PSPC1 shRNA Plasmid

20-abx960609
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSPC1 Recombinant Protein (Human)

RP025045 100 ug Ask for price

PSPC1 Recombinant Protein (Rat)

RP222725 100 ug Ask for price

PSPC1 Recombinant Protein (Mouse)

RP165395 100 ug Ask for price

PSPC1 ORF Vector (Human) (pORF)

ORF008349 1.0 ug DNA
EUR 95

Pspc1 ORF Vector (Rat) (pORF)

ORF074243 1.0 ug DNA
EUR 506

Pspc1 ORF Vector (Mouse) (pORF)

ORF055133 1.0 ug DNA
EUR 506

PSPC1-OT1 Recombinant Protein (Human)

RP085503 100 ug Ask for price

PSPC1 sgRNA CRISPR Lentivector set (Human)

K1746901 3 x 1.0 ug
EUR 339

Pspc1 sgRNA CRISPR Lentivector set (Rat)

K7459201 3 x 1.0 ug
EUR 339

Pspc1 sgRNA CRISPR Lentivector set (Mouse)

K4813201 3 x 1.0 ug
EUR 339

PSPC1-AS1 ORF Vector (Human) (pORF)

ORF028501 1.0 ug DNA Ask for price

PSPC1-OT1 ORF Vector (Human) (pORF)

ORF028502 1.0 ug DNA Ask for price

Mouse Paraspeckle component 1, Pspc1 ELISA KIT

ELI-22155m 96 Tests
EUR 865

Chicken Paraspeckle component 1, PSPC1 ELISA KIT

ELI-15492c 96 Tests
EUR 928

Human Paraspeckle component 1, PSPC1 ELISA KIT

ELI-45456h 96 Tests
EUR 824

Bovine Paraspeckle component 1, PSPC1 ELISA KIT

ELI-30610b 96 Tests
EUR 928

Human Paraspeckle Component 1 (PSPC1) ELISA Kit

abx382541-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

PSPC1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1746902 1.0 ug DNA
EUR 154

PSPC1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1746903 1.0 ug DNA
EUR 154

PSPC1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1746904 1.0 ug DNA
EUR 154

Pspc1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7459202 1.0 ug DNA
EUR 154

Pspc1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7459203 1.0 ug DNA
EUR 154

Pspc1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7459204 1.0 ug DNA
EUR 154

Pspc1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4813202 1.0 ug DNA
EUR 154

Pspc1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4813203 1.0 ug DNA
EUR 154

Pspc1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4813204 1.0 ug DNA
EUR 154

PSPC1 Protein Vector (Human) (pPB-C-His)

PV033393 500 ng
EUR 329

PSPC1 Protein Vector (Human) (pPB-N-His)

PV033394 500 ng
EUR 329

PSPC1 Protein Vector (Human) (pPM-C-HA)

PV033395 500 ng
EUR 329

PSPC1 Protein Vector (Human) (pPM-C-His)

PV033396 500 ng
EUR 329

PSPC1 Protein Vector (Rat) (pPB-C-His)

PV296970 500 ng
EUR 603

PSPC1 Protein Vector (Rat) (pPB-N-His)

PV296971 500 ng
EUR 603

PSPC1 Protein Vector (Rat) (pPM-C-HA)

PV296972 500 ng
EUR 603

PSPC1 Protein Vector (Rat) (pPM-C-His)

PV296973 500 ng
EUR 603

PSPC1 Protein Vector (Mouse) (pPB-C-His)

PV220530 500 ng
EUR 603

PSPC1 Protein Vector (Mouse) (pPB-N-His)

PV220531 500 ng
EUR 603

PSPC1 Protein Vector (Mouse) (pPM-C-HA)

PV220532 500 ng
EUR 603

PSPC1 Protein Vector (Mouse) (pPM-C-His)

PV220533 500 ng
EUR 603

Pspc1 3'UTR GFP Stable Cell Line

TU167206 1.0 ml Ask for price

PSPC1 3'UTR Luciferase Stable Cell Line

TU019112 1.0 ml
EUR 1394

Pspc1 3'UTR Luciferase Stable Cell Line

TU117206 1.0 ml Ask for price

PSPC1 3'UTR GFP Stable Cell Line

TU069112 1.0 ml
EUR 1394

Pspc1 3'UTR GFP Stable Cell Line

TU266996 1.0 ml Ask for price

Pspc1 3'UTR Luciferase Stable Cell Line

TU216996 1.0 ml Ask for price

PSPC1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV695761 1.0 ug DNA
EUR 682

PSPC1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV695765 1.0 ug DNA
EUR 682

PSPC1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV695766 1.0 ug DNA
EUR 682

PSPC1-OT1 Protein Vector (Human) (pPB-C-His)

PV114006 500 ng Ask for price

PSPC1-OT1 Protein Vector (Human) (pPB-N-His)

PV114007 500 ng Ask for price

PSPC1-OT1 Protein Vector (Human) (pPM-C-HA)

PV114008 500 ng Ask for price

PSPC1-OT1 Protein Vector (Human) (pPM-C-His)

PV114009 500 ng Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PSPC1 Rabbit Polyclonal Antibody