PTPRK Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

PTPRK Polyclonal Antibody
ABP60040-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PTPRK protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRK from Human, Mouse. This PTPRK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRK protein at amino acid sequence of 180-260
PTPRK Polyclonal Antibody
ABP60040-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PTPRK protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRK from Human, Mouse. This PTPRK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRK protein at amino acid sequence of 180-260
PTPRK Polyclonal Antibody
ES10142-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PTPRK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PTPRK Polyclonal Antibody
ES10142-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PTPRK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PTPRK Rabbit pAb
A14773-100ul 100 ul
EUR 308
PTPRK Rabbit pAb
A14773-200ul 200 ul
EUR 459
PTPRK Rabbit pAb
A14773-20ul 20 ul
EUR 183
PTPRK Rabbit pAb
A14773-50ul 50 ul
EUR 223
PTPRK Antibody
35901-100ul 100ul
EUR 252
PTPRK Antibody
1-CSB-PA613588LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRK. Recognizes PTPRK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200
PTPRK Antibody
DF9842 200ul
EUR 304
Description: PTPRK Antibody detects endogenous levels of total PTPRK.
PTPRK Antibody
ABD9842 100 ug
EUR 438
Rabbit PTPRK ELISA Kit
ERTP0176 96Tests
EUR 521
PTPRK Conjugated Antibody
C35901 100ul
EUR 397
Anti-PTPRK antibody
STJ116973 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation.
Anti-PTPRK antibody
STJ191300 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PTPRK
PTPRK siRNA
20-abx930410
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PTPRK siRNA
20-abx930411
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PTPRK Antibody, HRP conjugated
1-CSB-PA613588LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRK. Recognizes PTPRK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PTPRK Antibody, FITC conjugated
1-CSB-PA613588LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRK. Recognizes PTPRK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PTPRK Antibody, Biotin conjugated
1-CSB-PA613588LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRK. Recognizes PTPRK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
PTPRK Blocking Peptide
DF9842-BP 1mg
EUR 195
PTPRK cloning plasmid
CSB-CL613588HU-10ug 10ug
EUR 185
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 234
  • Sequence: atggatacgactgcggcggcggcgctgcctgcttttgtggcgctcttgctcctctctccttggcctctcctgggatcggcccaaggccagttctccgcagtgtctgtgcttgtggtcggtaacttttgctgctgttgttctgctgctgtctgccattccattcgccatctatcacg
  • Show more
Description: A cloning plasmid for the PTPRK gene.
Protein tyrosine phosphatase receptor type K (PTPRK) polyclonal antibody
ABP-PAB-11046 100 ug Ask for price
    • Product line: Phosphatases
    • Brand:
Human PTPRK ELISA Kit
EHP0176 96Tests
EUR 521
Bovine PTPRK ELISA Kit
EBP0176 96Tests
EUR 521
Anserini PTPRK ELISA Kit
EAP0176 96Tests
EUR 521
Canine PTPRK ELISA Kit
ECP0176 96Tests
EUR 521

PTPRK Rabbit Polyclonal Antibody