RFPL2 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

RFPL2 Rabbit pAb

A14604-100ul 100 ul
EUR 308

RFPL2 Rabbit pAb

A14604-200ul 200 ul
EUR 459

RFPL2 Rabbit pAb

A14604-20ul 20 ul
EUR 183

RFPL2 Rabbit pAb

A14604-50ul 50 ul
EUR 223

RFPL2 Rabbit pAb

A7578-100ul 100 ul
EUR 308

RFPL2 Rabbit pAb

A7578-200ul 200 ul
EUR 459

RFPL2 Rabbit pAb

A7578-20ul 20 ul
EUR 183

RFPL2 Rabbit pAb

A7578-50ul 50 ul
EUR 223

RFPL2 Antibody

46198-100ul 100ul
EUR 252

RFPL2 Antibody

46198-50ul 50ul
EUR 187

RFPL2 Antibody

DF9850 200ul
EUR 304
Description: RFPL2 Antibody detects endogenous levels of total RFPL2.

RFPL2 antibody

70R-3277 50 ug
EUR 467
Description: Rabbit polyclonal RFPL2 antibody raised against the C terminal of RFPL2

RFPL2 Antibody

abx145085-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

RFPL2 Antibody

1-CSB-PA019599ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RFPL2. Recognizes RFPL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RFPL2 Antibody

1-CSB-PA019599ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RFPL2. Recognizes RFPL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RFPL2 Antibody

ABD9850 100 ug
EUR 438

RFPL2 Conjugated Antibody

C46198 100ul
EUR 397

Anti-RFPL2 antibody

STJ116814 100 µl
EUR 277

Anti-RFPL2 antibody

STJ29715 100 µl
EUR 277

Anti-RFPL2 antibody

STJ191312 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RFPL2

Polyclonal RFPL2 antibody - C-terminal region

APR13090G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RFPL2 - C-terminal region. This antibody is tested and proven to work in the following applications:

RFPL2 siRNA

20-abx931322
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal RFPL2 and RFPL3 Antibody (C-Term)

APR13089G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RFPL2 and RFPL3 (C-Term). This antibody is tested and proven to work in the following applications:

RFPL2 and RFPL3 Antibody

abx433225-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

RFPL2 Blocking Peptide

33R-9802 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RFPL2 antibody, catalog no. 70R-3277

RFPL2 Blocking Peptide

DF9850-BP 1mg
EUR 195

RFPL2 cloning plasmid

CSB-CL019599HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 867
  • Sequence: atggctgcactcttccaagaagcaagcagctgtcccgtctgctcagactatctggaaaaaccaatgtccctggagtgtggatgcgccgtctgcctcaagtgcattaattcactgcagaaggagccccatggggaggatctactttgctgttgctcttccatggtctctcggaagaa
  • Show more
Description: A cloning plasmid for the RFPL2 gene.

Anti-RFPL2 and RFPL3 antibody

STJ70315 100 µg
EUR 260

Human RFPL2 shRNA Plasmid

20-abx957317
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RFPL2 Recombinant Protein (Human)

RP026236 100 ug Ask for price

RFPL2 ORF Vector (Human) (pORF)

ORF008746 1.0 ug DNA
EUR 95

Ret Finger Protein-Like 2 (RFPL2) Antibody

20-abx007029
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ret Finger Protein-Like 2 (RFPL2) Antibody

20-abx218266
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ret Finger Protein-Like 2 (RFPL2) Antibody

20-abx321879
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ret Finger Protein-Like 2 (RFPL2) Antibody

20-abx321880
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RFPL2 sgRNA CRISPR Lentivector set (Human)

K1812401 3 x 1.0 ug
EUR 339

RFPL2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1812402 1.0 ug DNA
EUR 154

RFPL2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1812403 1.0 ug DNA
EUR 154

RFPL2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1812404 1.0 ug DNA
EUR 154

RFPL2 Protein Vector (Human) (pPB-C-His)

PV034981 500 ng
EUR 329

RFPL2 Rabbit Polyclonal Antibody