RGS20 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
 RGS20 Polyclonal Antibody |
|
ES10148-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against RGS20 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 RGS20 Rabbit pAb |
|
A8167-100ul |
Abclonal |
100 ul |
EUR 308 |
RGS20 Rabbit pAb |
|
A8167-200ul |
Abclonal |
200 ul |
EUR 459 |
RGS20 Rabbit pAb |
|
A8167-20ul |
Abclonal |
20 ul |
EUR 183 |
RGS20 Rabbit pAb |
|
A8167-50ul |
Abclonal |
50 ul |
EUR 223 |
) Polyclonal RGS20 Antibody (Center) |
|
AMM07590G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS20 (Center). This antibody is tested and proven to work in the following applications: |
 RGS20 antibody |
|
70R-1129 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal RGS20 antibody raised against the N terminal of RGS20 |
RGS20 antibody |
|
70R-1143 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal RGS20 antibody raised against the middle region of RGS20 |
RGS20 antibody |
|
70R-19875 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal RGS20 antibody |
 RGS20 Antibody |
|
46197-100ul |
SAB |
100ul |
EUR 252 |
RGS20 Antibody |
|
46197-50ul |
SAB |
50ul |
EUR 187 |
RGS20 Antibody |
|
DF9846 |
Affbiotech |
200ul |
EUR 304 |
|
Description: RGS20 Antibody detects endogenous levels of total RGS20. |
RGS20 antibody |
|
70R-51346 |
Fitzgerald |
100 ul |
EUR 244 |
|
Description: Purified Polyclonal RGS20 antibody |
RGS20 Antibody |
|
1-CSB-PA019652ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against RGS20. Recognizes RGS20 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200, IF:1:50-1:200 |
RGS20 Antibody |
|
1-CSB-PA019652GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against RGS20. Recognizes RGS20 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 Polyclonal RGS20 antibody - N-terminal region |
|
AMM07592G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS20 - N-terminal region. This antibody is tested and proven to work in the following applications: |
 RGS20 Conjugated Antibody |
|
C46197 |
SAB |
100ul |
EUR 397 |
 Anti-RGS20 antibody |
|
STJ110466 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene belongs to the family of regulator of G protein signaling (RGS) proteins, which are regulatory and structural components of G protein-coupled receptor complexes. RGS proteins inhibit signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound forms. This protein selectively binds to G(z)-alpha and G(alpha)-i2 subunits, and regulates their signaling activities. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-RGS20 antibody |
|
STJ191306 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to RGS20 |
 RGS20 siRNA |
|
20-abx931406 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RGS20 siRNA |
|
20-abx931407 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-RGS20 |
|
YF-PA15737 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to RGS20 |
anti-RGS20 |
|
YF-PA15738 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to RGS20 |
anti-RGS20 |
|
YF-PA15739 |
Abfrontier |
100 ul |
EUR 403 |
|
Description: Rabbit polyclonal to RGS20 |
anti-RGS20 |
|
YF-PA15740 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to RGS20 |
anti-RGS20 |
|
YF-PA25140 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to RGS20 |
 RGS20 Blocking Peptide |
|
33R-4413 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS20 antibody, catalog no. 70R-1129 |
RGS20 Blocking Peptide |
|
33R-6636 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS20 antibody, catalog no. 70R-1143 |
RGS20 Blocking Peptide |
|
DF9846-BP |
Affbiotech |
1mg |
EUR 195 |
RGS20 Blocking Peptide |
|
20-abx064221 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 RGS20 cloning plasmid |
|
CSB-CL019652HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 654
- Sequence: atgggatcagagcggatggagatgcggaagcggcagatgcccgccgcccaggacacaccaggcgccgccccaggccagcccggagcggggagtcgcgggtccaacgcatgctgcttctgctggtgctgctgttgtagctgctcgtgtctcactgttagaaaccaggaagatcagag
- Show more
|
|
Description: A cloning plasmid for the RGS20 gene. |
RGS20 cloning plasmid |
|
CSB-CL019652HU2-10ug |
Cusabio |
10ug |
EUR 313 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 726
- Sequence: atgcgcacggcggacggaggcgagccggccggggcttcctccccggccggcagggtggacggtgggctccagatgggatcagagcggatggagatgcggaagcggcagatgcccgccgcccaggacacaccaggcgccgccccaggccagcccggagcggggagtcgcgggtccaa
- Show more
|
|
Description: A cloning plasmid for the RGS20 gene. |
RGS20 Rabbit Polyclonal Antibody
