RGS20 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

RGS20 Polyclonal Antibody

ES10148-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RGS20 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RGS20 Rabbit pAb

A8167-100ul 100 ul
EUR 308

RGS20 Rabbit pAb

A8167-200ul 200 ul
EUR 459

RGS20 Rabbit pAb

A8167-20ul 20 ul
EUR 183

RGS20 Rabbit pAb

A8167-50ul 50 ul
EUR 223

Polyclonal RGS20 Antibody (Center)

AMM07590G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS20 (Center). This antibody is tested and proven to work in the following applications:

RGS20 antibody

70R-1129 100 ug
EUR 377
Description: Rabbit polyclonal RGS20 antibody raised against the N terminal of RGS20

RGS20 antibody

70R-1143 100 ug
EUR 377
Description: Rabbit polyclonal RGS20 antibody raised against the middle region of RGS20

RGS20 antibody

70R-19875 50 ul
EUR 435
Description: Rabbit polyclonal RGS20 antibody

RGS20 Antibody

46197-100ul 100ul
EUR 252

RGS20 Antibody

46197-50ul 50ul
EUR 187

RGS20 Antibody

DF9846 200ul
EUR 304
Description: RGS20 Antibody detects endogenous levels of total RGS20.

RGS20 antibody

70R-51346 100 ul
EUR 244
Description: Purified Polyclonal RGS20 antibody

RGS20 Antibody

1-CSB-PA019652ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RGS20. Recognizes RGS20 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200, IF:1:50-1:200

RGS20 Antibody

1-CSB-PA019652GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RGS20. Recognizes RGS20 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RGS20 Antibody

ABD13235 100 ug
EUR 438

RGS20 Antibody

ABD9846 100 ug
EUR 438

Polyclonal RGS20 antibody - N-terminal region

AMM07592G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS20 - N-terminal region. This antibody is tested and proven to work in the following applications:

RGS20 Conjugated Antibody

C46197 100ul
EUR 397

Anti-RGS20 antibody

STJ110466 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the family of regulator of G protein signaling (RGS) proteins, which are regulatory and structural components of G protein-coupled receptor complexes. RGS proteins inhibit signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound forms. This protein selectively binds to G(z)-alpha and G(alpha)-i2 subunits, and regulates their signaling activities. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RGS20 antibody

STJ191306 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RGS20

RGS20 siRNA

20-abx931406
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGS20 siRNA

20-abx931407
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RGS20

YF-PA15737 50 ul
EUR 363
Description: Mouse polyclonal to RGS20

anti-RGS20

YF-PA15738 50 ug
EUR 363
Description: Mouse polyclonal to RGS20

anti-RGS20

YF-PA15739 100 ul
EUR 403
Description: Rabbit polyclonal to RGS20

anti-RGS20

YF-PA15740 100 ug
EUR 403
Description: Rabbit polyclonal to RGS20

anti-RGS20

YF-PA25140 50 ul
EUR 334
Description: Mouse polyclonal to RGS20

RGS20 Blocking Peptide

33R-4413 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS20 antibody, catalog no. 70R-1129

RGS20 Blocking Peptide

33R-6636 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS20 antibody, catalog no. 70R-1143

RGS20 Blocking Peptide

DF9846-BP 1mg
EUR 195

RGS20 Blocking Peptide

20-abx064221
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RGS20 cloning plasmid

CSB-CL019652HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atgggatcagagcggatggagatgcggaagcggcagatgcccgccgcccaggacacaccaggcgccgccccaggccagcccggagcggggagtcgcgggtccaacgcatgctgcttctgctggtgctgctgttgtagctgctcgtgtctcactgttagaaaccaggaagatcagag
  • Show more
Description: A cloning plasmid for the RGS20 gene.

RGS20 cloning plasmid

CSB-CL019652HU2-10ug 10ug
EUR 313
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 726
  • Sequence: atgcgcacggcggacggaggcgagccggccggggcttcctccccggccggcagggtggacggtgggctccagatgggatcagagcggatggagatgcggaagcggcagatgcccgccgcccaggacacaccaggcgccgccccaggccagcccggagcggggagtcgcgggtccaa
  • Show more
Description: A cloning plasmid for the RGS20 gene.

RGS20 Rabbit Polyclonal Antibody