RHOQ Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

RHOQ Polyclonal Antibody
ABP60171-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RHOQ protein at amino acid sequence of 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of RHOQ from Human, Mouse, Rat. This RHOQ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHOQ protein at amino acid sequence of 60-140
RHOQ Polyclonal Antibody
ABP60171-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RHOQ protein at amino acid sequence of 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of RHOQ from Human, Mouse, Rat. This RHOQ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHOQ protein at amino acid sequence of 60-140
RHOQ Polyclonal Antibody
ES10177-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RHOQ from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
RHOQ Polyclonal Antibody
ES10177-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RHOQ from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
RHOQ Rabbit pAb
A17401-100ul 100 ul Ask for price
RHOQ Rabbit pAb
A17401-200ul 200 ul Ask for price
RHOQ Rabbit pAb
A17401-20ul 20 ul Ask for price
RHOQ Rabbit pAb
A17401-50ul 50 ul
EUR 384
RHOQ antibody
70R-19889 50 ul
EUR 435
Description: Rabbit polyclonal RHOQ antibody
RHOQ Antibody
45090-100ul 100ul
EUR 252
RHOQ Antibody
45090-50ul 50ul
EUR 187
RHOQ Antibody
DF7643 200ul
EUR 304
Description: RHOQ Antibody detects endogenous levels of total RHOQ.
RHOQ Antibody
1-CSB-PA019693GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RHOQ. Recognizes RHOQ from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
RHOQ Antibody
ABD7643 100 ug
EUR 438
Rhoq/ Rat Rhoq ELISA Kit
ELI-45212r 96 Tests
EUR 886
RHOQ Conjugated Antibody
C45090 100ul
EUR 397
Anti-RHOQ antibody
STJ119523 50 µl
EUR 393
Description: NA
Anti-RHOQ antibody
STJ191335 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RHOQ
RHOQ siRNA
20-abx904571
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RHOQ siRNA
20-abx931484
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RHOQ siRNA
20-abx931485
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Rho-Related GTP-Binding Protein RhoQ (RHOQ) Protein
20-abx262613
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
RHOQ Blocking Peptide
DF7643-BP 1mg
EUR 195
RHOQ cloning plasmid
CSB-CL019693HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 618
  • Sequence: ATGGCTCACGGGCCCGGCGCGCTGATGCTCAAGTGCGTGGTGGTCGGCGACGGGGCGGTGGGCAAGACGTGCCTACTCATGAGCTATGCCAACGACGCCTTCCCGGAGGAGTACGTGCCCACCGTCTTCGACCACTACGCAGTCAGCGTCACCGTGGGGGGCAAGCAGTACCTCCT
  • Show more
Description: A cloning plasmid for the RHOQ gene.
pCMV-SPORT6-RHOQ
PVT14161 2 ug
EUR 495
Human Rho- related GTP- binding protein RhoQ, RHOQ ELISA KIT
ELI-18505h 96 Tests
EUR 824
Mouse Rho- related GTP- binding protein RhoQ, Rhoq ELISA KIT
ELI-38885m 96 Tests
EUR 865
RHOQ protein (His tag)
80R-2786 50 ug
EUR 322
Description: Purified recombinant RHOQ protein (His tag)
Rat RHOQ shRNA Plasmid
20-abx987025
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RHOQ shRNA Plasmid
20-abx958268
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse RHOQ shRNA Plasmid
20-abx979628
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RhoQ Recombinant Protein (Human)
RP042877 100 ug Ask for price
RhoQ Recombinant Protein (Mouse)
RP168041 100 ug Ask for price
RhoQ Recombinant Protein (Rat)
RP226058 100 ug Ask for price
Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human)
4-PAE328Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ)
Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), APC
4-PAE328Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with APC.
Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), Biotinylated
4-PAE328Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with Biotin.
Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), Cy3
4-PAE328Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with Cy3.
Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), FITC
4-PAE328Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with FITC.
Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), HRP
4-PAE328Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with HRP.
Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), PE
4-PAE328Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with PE.
Rhoq ORF Vector (Rat) (pORF)
ORF075354 1.0 ug DNA
EUR 506
RHOQ ORF Vector (Human) (pORF)
ORF014293 1.0 ug DNA
EUR 354
Rhoq ORF Vector (Mouse) (pORF)
ORF056015 1.0 ug DNA
EUR 506
Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), APC-Cy7
4-PAE328Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with APC-Cy7.
Ras Homolog Gene Family, Member Q (RHOQ) Antibody
20-abx218294
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ras Homolog Gene Family, Member Q (RHOQ) Antibody
20-abx129116
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Ras Homolog Gene Family, Member Q (RHOQ) Antibody
abx146452-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Rhoq sgRNA CRISPR Lentivector set (Rat)
K6994901 3 x 1.0 ug
EUR 339
Rhoq sgRNA CRISPR Lentivector set (Mouse)
K3253301 3 x 1.0 ug
EUR 339
RhoQ sgRNA CRISPR Lentivector set (Human)
K0004301 3 x 1.0 ug
EUR 339
Rhoq sgRNA CRISPR Lentivector (Rat) (Target 1)
K6994902 1.0 ug DNA
EUR 154
Rhoq sgRNA CRISPR Lentivector (Rat) (Target 2)
K6994903 1.0 ug DNA
EUR 154
Rhoq sgRNA CRISPR Lentivector (Rat) (Target 3)
K6994904 1.0 ug DNA
EUR 154
Rhoq sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3253302 1.0 ug DNA
EUR 154
Rhoq sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3253303 1.0 ug DNA
EUR 154
Rhoq sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3253304 1.0 ug DNA
EUR 154
RhoQ sgRNA CRISPR Lentivector (Human) (Target 1)
K0004302 1.0 ug DNA
EUR 154
RhoQ sgRNA CRISPR Lentivector (Human) (Target 2)
K0004303 1.0 ug DNA
EUR 154
RhoQ sgRNA CRISPR Lentivector (Human) (Target 3)
K0004304 1.0 ug DNA
EUR 154
RhoQ Protein Vector (Rat) (pPB-C-His)
PV301414 500 ng
EUR 603
RhoQ Protein Vector (Rat) (pPB-N-His)
PV301415 500 ng
EUR 603
RhoQ Protein Vector (Rat) (pPM-C-HA)
PV301416 500 ng
EUR 603

RHOQ Rabbit Polyclonal Antibody