RND3 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

RND3 Polyclonal Antibody
ABP60219-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RND3 protein at amino acid sequence of 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of RND3 from Human, Mouse, Rat. This RND3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RND3 protein at amino acid sequence of 150-230
RND3 Polyclonal Antibody
ABP60219-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RND3 protein at amino acid sequence of 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of RND3 from Human, Mouse, Rat. This RND3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RND3 protein at amino acid sequence of 150-230
RND3 Polyclonal Antibody
ES10173-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RND3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
RND3 Polyclonal Antibody
ES10173-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RND3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
RND3 Rabbit pAb
A11637-100ul 100 ul
EUR 308
RND3 Rabbit pAb
A11637-200ul 200 ul
EUR 459
RND3 Rabbit pAb
A11637-20ul 20 ul
EUR 183
RND3 Rabbit pAb
A11637-50ul 50 ul
EUR 223
RND3 Rabbit pAb
A17402-100ul 100 ul
EUR 308
RND3 Rabbit pAb
A17402-200ul 200 ul Ask for price
RND3 Rabbit pAb
A17402-20ul 20 ul Ask for price
RND3 Rabbit pAb
A17402-50ul 50 ul Ask for price
RND3 antibody
70R-19917 50 ul
EUR 435
Description: Rabbit polyclonal RND3 antibody
RND3 Antibody
48418-100ul 100ul
EUR 333
RND3 Antibody
48418-50ul 50ul
EUR 239
RND3 Antibody
DF12311 200ul
EUR 304
Description: RND3 antibody detects endogenous levels of RND3.
RND3 Antibody
1-CSB-PA019813GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
RND3 Antibody
1-CSB-PA019813LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
Rnd3/ Rat Rnd3 ELISA Kit
ELI-14681r 96 Tests
EUR 886
Human RND3 Antibody
33068-05111 150 ug
EUR 261
RND3 Conjugated Antibody
C48418 100ul
EUR 397
anti- RND3 antibody
FNab07333 100µg
EUR 548.75
  • Immunogen: Rho family GTPase 3
  • Uniprot ID: P61587
  • Gene ID: 390
  • Research Area: Signal Transduction
Description: Antibody raised against RND3
anti- RND3 antibody
FNab07334 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: Rho family GTPase 3
  • Uniprot ID: P61587
  • Gene ID: 390
  • Research Area: Signal Transduction
Description: Antibody raised against RND3
Anti-RND3 antibody
PAab07333 100 ug
EUR 386
Anti-RND3 antibody
STJ113242 100 µl
EUR 277
Description: This gene encodes a protein which is a member of the small GTPase protein superfamily. The encoded protein binds only GTP but has no GTPase activity, and appears to act as a negative regulator of cytoskeletal organization leading to loss of adhesion. Multiple alternatively spliced variants, encoding the same protein, have been identified.
Anti-RND3 antibody
STJ119524 100 µl
EUR 277
Description: This gene encodes a protein which is a member of the small GTPase protein superfamily. The encoded protein binds only GTP but has no GTPase activity, and appears to act as a negative regulator of cytoskeletal organization leading to loss of adhesion. Multiple alternatively spliced variants, encoding the same protein, have been identified.
Anti-RND3 antibody
STJ191331 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RND3
RND3 siRNA
20-abx904598
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RND3 siRNA
20-abx931651
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RND3 siRNA
20-abx931652
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-RND3
YF-PA10316 50 ul
EUR 363
Description: Mouse polyclonal to RND3
anti-RND3
YF-PA10317 50 ug
EUR 363
Description: Mouse polyclonal to RND3
RND3 Antibody, HRP conjugated
1-CSB-PA019813LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RND3 Antibody, FITC conjugated
1-CSB-PA019813LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RND3 Antibody, Biotin conjugated
1-CSB-PA019813LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
RND3 Blocking Peptide
DF12311-BP 1mg
EUR 195
RND3 cloning plasmid
CSB-CL019813HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 735
  • Sequence: atgaaggagagaagagccagccagaaattatccagcaaatctatcatggatcctaatcagaacgtgaaatgcaagatagttgtggtgggagacagtcagtgtggaaaaactgcgctgctccatgtcttcgccaaggactgcttccccgagaattacgttcctacagtgtttgagaa
  • Show more
Description: A cloning plasmid for the RND3 gene.
Anti-RND3 (1D2)
YF-MA10058 100 ug
EUR 363
Description: Mouse monoclonal to RND3
Human RND3 Antibody (Biotin Conjugate)
33068-05121 150 ug
EUR 369
Monoclonal RND3 Antibody, Clone: 5C7E8
AMM03058G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human RND3. The antibodies are raised in Mouse and are from clone 5C7E8. This antibody is applicable in WB and IHC, FC, ICC, E
Monoclonal RND3 Antibody, Clone: 5C7B6
AMM03059G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human RND3. The antibodies are raised in Mouse and are from clone 5C7B6. This antibody is applicable in WB and IHC, FC, ICC, E
RND3 protein (His tag)
80R-1413 100 ug
EUR 305
Description: Purified recombinant Human RND3 protein
RND3 ELISA KIT|Human
EF002501 96 Tests
EUR 689
Rat RND3 shRNA Plasmid
20-abx988763
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse RND3 shRNA Plasmid
20-abx978141
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RND3 shRNA Plasmid
20-abx950279
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RND3 Recombinant Protein (Human)
RP026548 100 ug Ask for price
RND3 Recombinant Protein (Mouse)
RP168410 100 ug Ask for price
RND3 Recombinant Protein (Rat)
RP226271 100 ug Ask for price
Human RND3 AssayLite Antibody (FITC Conjugate)
33068-05141 150 ug
EUR 428
Human RND3 AssayLite Antibody (RPE Conjugate)
33068-05151 150 ug
EUR 428
Human RND3 AssayLite Antibody (APC Conjugate)
33068-05161 150 ug
EUR 428
Human RND3 AssayLite Antibody (PerCP Conjugate)
33068-05171 150 ug
EUR 471
Rho Family Gtpase 3 (RND3) Antibody
20-abx115177
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rnd3 ORF Vector (Rat) (pORF)
ORF075425 1.0 ug DNA
EUR 506
RND3 ORF Vector (Human) (pORF)
ORF008850 1.0 ug DNA
EUR 95
Rnd3 ORF Vector (Mouse) (pORF)
ORF056138 1.0 ug DNA
EUR 506
Rho-Related GTP-Binding Protein RhoE (RND3) Antibody
abx016165-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Rho-Related GTP-Binding Protein RhoE (RND3) Antibody
abx224184-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

RND3 Rabbit Polyclonal Antibody