RPAP1 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

RPAP1 Polyclonal Antibody

ES10188-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RPAP1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RPAP1 antibody

70R-19951 50 ul
EUR 435
Description: Rabbit polyclonal RPAP1 antibody

RPAP1 Antibody

46216-100ul 100ul
EUR 252

RPAP1 Antibody

46216-50ul 50ul
EUR 187

RPAP1 Antibody

DF9874 200ul
EUR 304
Description: RPAP1 Antibody detects endogenous levels of total RPAP1.

RPAP1 antibody

70R-50926 100 ul
EUR 244
Description: Purified Polyclonal RPAP1 antibody

RPAP1 Antibody

1-CSB-PA020094GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPAP1. Recognizes RPAP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RPAP1 Antibody

ABD9874 100 ug
EUR 438

Rpap1/ Rat Rpap1 ELISA Kit

ELI-18351r 96 Tests
EUR 886

RPAP1 Conjugated Antibody

C46216 100ul
EUR 397

anti- RPAP1 antibody

FNab07395 100µg
EUR 548.75
  • Immunogen: RNA polymerase II associated protein 1
  • Uniprot ID: Q9BWH6
  • Gene ID: 26015
  • Research Area: Metabolism
Description: Antibody raised against RPAP1

anti- RPAP1 antibody

FNab07396 100µg
EUR 585
  • Immunogen: RNA polymerase II associated protein 1
  • Uniprot ID: Q9BWH6
  • Gene ID: 26015
  • Research Area: Metabolism
Description: Antibody raised against RPAP1

Anti-RPAP1 antibody

PAab07395 100 ug
EUR 386

Anti-RPAP1 antibody

PAab07396 100 ug
EUR 412

Anti-RPAP1 antibody

STJ191346 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RPAP1

RPAP1 siRNA

20-abx904639
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPAP1 siRNA

20-abx931878
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPAP1 siRNA

20-abx931879
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPAP1 Blocking Peptide

DF9874-BP 1mg
EUR 195

RPAP1 Blocking Peptide

20-abx063801
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RPAP1 cloning plasmid

CSB-CL887140HU-10ug 10ug
EUR 1641
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4182
  • Sequence: atgctgtcgagaccgaagccaggggagtccgaggtggacctgctgcacttccagagtcagtttctcgcagctggtgcagccccagcagtgcagctggtgaagaaaggaaataggggcggtggtgatgccaactcagaccggcctccgctccaggaccatcgggatgtggtgatgt
  • Show more
Description: A cloning plasmid for the RPAP1 gene.

RNA polymerase II associated protein 1 (RPAP1) polyclonal antibody

ABP-PAB-11687 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

RPAP1 ELISA KIT|Human

EF002555 96 Tests
EUR 689

Rat RPAP1 shRNA Plasmid

20-abx989666
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RPAP1 shRNA Plasmid

20-abx976783
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RPAP1 shRNA Plasmid

20-abx958654
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rpap1 ORF Vector (Rat) (pORF)

ORF075521 1.0 ug DNA
EUR 2080

RPAP1 ORF Vector (Human) (pORF)

ORF008931 1.0 ug DNA
EUR 95

Rpap1 ORF Vector (Mouse) (pORF)

ORF056294 1.0 ug DNA
EUR 1572

Rpap1 ORF Vector (Mouse) (pORF)

ORF056295 1.0 ug DNA
EUR 1572

RNA Polymerase II Associated Protein 1 (RPAP1) Antibody

20-abx008210
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

RNA Polymerase II Associated Protein 1 (RPAP1) Antibody

20-abx218344
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RNA Polymerase II Associated Protein 1 (RPAP1) Antibody

abx029304-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

RNA Polymerase II Associated Protein 1 (RPAP1) Antibody

abx029304-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RNA Polymerase II Associated Protein 1 (RPAP1) Antibody

abx237395-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RNA Polymerase II Associated Protein 1 (RPAP1) Antibody

abx237396-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Rpap1 sgRNA CRISPR Lentivector set (Mouse)

K4890801 3 x 1.0 ug
EUR 339

Rpap1 sgRNA CRISPR Lentivector set (Rat)

K6490501 3 x 1.0 ug
EUR 339

RPAP1 sgRNA CRISPR Lentivector set (Human)

K1871601 3 x 1.0 ug
EUR 339

Rpap1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4890802 1.0 ug DNA
EUR 154

Rpap1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4890803 1.0 ug DNA
EUR 154

Rpap1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4890804 1.0 ug DNA
EUR 154

Rpap1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6490502 1.0 ug DNA
EUR 154

Rpap1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6490503 1.0 ug DNA
EUR 154

Rpap1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6490504 1.0 ug DNA
EUR 154

RPAP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1871602 1.0 ug DNA
EUR 154

RPAP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1871603 1.0 ug DNA
EUR 154

RPAP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1871604 1.0 ug DNA
EUR 154

RPAP1 Protein Vector (Rat) (pPB-C-His)

PV302082 500 ng
EUR 2386

RPAP1 Protein Vector (Rat) (pPB-N-His)

PV302083 500 ng
EUR 2386

RPAP1 Protein Vector (Rat) (pPM-C-HA)

PV302084 500 ng
EUR 2386

RPAP1 Protein Vector (Rat) (pPM-C-His)

PV302085 500 ng
EUR 2386

RPAP1 Protein Vector (Human) (pPB-C-His)

PV035721 500 ng
EUR 329

RPAP1 Protein Vector (Human) (pPB-N-His)

PV035722 500 ng
EUR 329

RPAP1 Protein Vector (Human) (pPM-C-HA)

PV035723 500 ng
EUR 329

RPAP1 Protein Vector (Human) (pPM-C-His)

PV035724 500 ng
EUR 329

RPAP1 Protein Vector (Mouse) (pPB-C-His)

PV225174 500 ng
EUR 2399

RPAP1 Protein Vector (Mouse) (pPB-N-His)

PV225175 500 ng
EUR 2399

RPAP1 Protein Vector (Mouse) (pPM-C-HA)

PV225176 500 ng
EUR 2399

RPAP1 Protein Vector (Mouse) (pPM-C-His)

PV225177 500 ng
EUR 2399

RPAP1 Protein Vector (Mouse) (pPB-C-His)

PV225178 500 ng
EUR 2399

RPAP1 Protein Vector (Mouse) (pPB-N-His)

PV225179 500 ng
EUR 2399

RPAP1 Protein Vector (Mouse) (pPM-C-HA)

PV225180 500 ng
EUR 2399

RPAP1 Protein Vector (Mouse) (pPM-C-His)

PV225181 500 ng
EUR 2399

Rpap1 3'UTR Luciferase Stable Cell Line

TU118056 1.0 ml Ask for price

Rpap1 3'UTR GFP Stable Cell Line

TU168056 1.0 ml Ask for price

Rpap1 3'UTR Luciferase Stable Cell Line

TU219599 1.0 ml Ask for price

Rpap1 3'UTR GFP Stable Cell Line

TU269599 1.0 ml Ask for price

RPAP1 3'UTR GFP Stable Cell Line

TU070393 1.0 ml
EUR 1394

RPAP1 3'UTR Luciferase Stable Cell Line

TU020393 1.0 ml
EUR 1394

RPAP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV681583 1.0 ug DNA
EUR 2232

RPAP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV681587 1.0 ug DNA
EUR 2232

RPAP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV681588 1.0 ug DNA
EUR 2232

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

RPAP1 Rabbit Polyclonal Antibody