RPAP3 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

RPAP3 Polyclonal Antibody
ABP60240-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RPAP3 protein at amino acid sequence of 280-360
  • Applications tips:
Description: A polyclonal antibody for detection of RPAP3 from Human, Mouse, Rat. This RPAP3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RPAP3 protein at amino acid sequence of 280-360
RPAP3 Polyclonal Antibody
ABP60240-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RPAP3 protein at amino acid sequence of 280-360
  • Applications tips:
Description: A polyclonal antibody for detection of RPAP3 from Human, Mouse, Rat. This RPAP3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RPAP3 protein at amino acid sequence of 280-360
RPAP3 Polyclonal Antibody
ES10189-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RPAP3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
RPAP3 Polyclonal Antibody
ES10189-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RPAP3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
RPAP3 Rabbit pAb
A9575-100ul 100 ul
EUR 308
RPAP3 Rabbit pAb
A9575-200ul 200 ul
EUR 459
RPAP3 Rabbit pAb
A9575-20ul 20 ul Ask for price
RPAP3 Rabbit pAb
A9575-50ul 50 ul Ask for price
RPAP3 Rabbit pAb
A15239-100ul 100 ul
EUR 308
RPAP3 Rabbit pAb
A15239-200ul 200 ul
EUR 459
RPAP3 Rabbit pAb
A15239-20ul 20 ul
EUR 183
RPAP3 Rabbit pAb
A15239-50ul 50 ul
EUR 223
Polyclonal RPAP3 Antibody (Center)
AMM07647G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPAP3 (Center). This antibody is tested and proven to work in the following applications:
RPAP3 Antibody
35926-100ul 100ul
EUR 252
RPAP3 Antibody
1-CSB-PA092850
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPAP3. Recognizes RPAP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:15-1:50
RPAP3 Antibody
1-CSB-PA961254
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPAP3. Recognizes RPAP3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50
RPAP3 Antibody
DF9875 200ul
EUR 304
Description: RPAP3 Antibody detects endogenous levels of total RPAP3.
RPAP3 antibody
70R-51102 100 ul
EUR 244
Description: Purified Polyclonal RPAP3 antibody
RPAP3 Antibody
ABD9875 100 ug
EUR 438
Rpap3/ Rat Rpap3 ELISA Kit
ELI-18352r 96 Tests
EUR 886
RPAP3 Conjugated Antibody
C35926 100ul
EUR 397
anti- RPAP3 antibody
FNab07398 100µg
EUR 585
  • Immunogen: RNA polymerase II associated protein 3
  • Uniprot ID: Q9H6T3
  • Gene ID: 79657
  • Research Area: Metabolism
Description: Antibody raised against RPAP3
Anti-RPAP3 antibody
PAab07398 100 ug
EUR 412
Anti-RPAP3 antibody
STJ111750 100 µl
EUR 277
Description: This gene encodes an RNA polymerase II-associated protein. The encoded protein may function in transcriptional regulation and may also regulate apoptosis. Alternatively spliced transcript variants have been described.
Anti-RPAP3 antibody
STJ117433 100 µl
EUR 277
Description: This gene encodes an RNA polymerase II-associated protein. The encoded protein may function in transcriptional regulation and may also regulate apoptosis. Alternatively spliced transcript variants have been described.
Anti-RPAP3 antibody
STJ191347 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RPAP3
RPAP3 siRNA
20-abx904641
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPAP3 siRNA
20-abx931882
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPAP3 siRNA
20-abx931883
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPAP3 Blocking Peptide
DF9875-BP 1mg
EUR 195
RPAP3 Blocking Peptide
20-abx063977
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
RPAP3 cloning plasmid
CSB-CL862030HU-10ug 10ug
EUR 640
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1896
  • Sequence: atgacttcagcaaataaagcaatcgaattacaactacaagtgaaacaaaatgcagaagaattacaagactttatgcgggatttagaaaactgggaaaaagacattaaacaaaaggatatggaactaagaagacagaatggtgttcctgaagagaatttacctcctattcgaaatg
  • Show more
Description: A cloning plasmid for the RPAP3 gene.
RPAP3 ELISA KIT|Human
EF002557 96 Tests
EUR 689
Rat RPAP3 shRNA Plasmid
20-abx989035
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse RPAP3 shRNA Plasmid
20-abx977582
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RPAP3 shRNA Plasmid
20-abx962461
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RPAP3 Recombinant Protein (Human)
RP026797 100 ug Ask for price
RPAP3 Recombinant Protein (Mouse)
RP168893 100 ug Ask for price
RPAP3 Recombinant Protein (Rat)
RP226565 100 ug Ask for price
Rpap3 ORF Vector (Rat) (pORF)
ORF075523 1.0 ug DNA
EUR 506
RPAP3 ORF Vector (Human) (pORF)
ORF008933 1.0 ug DNA
EUR 95
Rpap3 ORF Vector (Mouse) (pORF)
ORF056299 1.0 ug DNA
EUR 506
Rabbit RNA polymerase II associated protein 3(RPAP3) ELISA kit
E04R0419-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit RNA polymerase II associated protein 3(RPAP3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit RNA polymerase II associated protein 3(RPAP3) ELISA kit
E04R0419-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit RNA polymerase II associated protein 3(RPAP3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit RNA polymerase II associated protein 3(RPAP3) ELISA kit
E04R0419-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit RNA polymerase II associated protein 3(RPAP3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
RNA Polymerase II Associated Protein 3 (RPAP3) Antibody
20-abx008038
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
RNA Polymerase II Associated Protein 3 (RPAP3) Antibody
20-abx213138
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
RNA Polymerase II Associated Protein 3 (RPAP3) Antibody
20-abx124003
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
RNA Polymerase II Associated Protein 3 (RPAP3) Antibody
abx030173-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
RNA Polymerase II Associated Protein 3 (RPAP3) Antibody
abx030173-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
RNA Polymerase II Associated Protein 3 (RPAP3) Antibody
20-abx339172
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
RNA Polymerase II Associated Protein 3 (RPAP3) Antibody
abx237398-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Rpap3 sgRNA CRISPR Lentivector set (Rat)
K7446801 3 x 1.0 ug
EUR 339
Rpap3 sgRNA CRISPR Lentivector set (Mouse)
K4819301 3 x 1.0 ug
EUR 339
RPAP3 sgRNA CRISPR Lentivector set (Human)
K1871801 3 x 1.0 ug
EUR 339
Rpap3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7446802 1.0 ug DNA
EUR 154
Rpap3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7446803 1.0 ug DNA
EUR 154
Rpap3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7446804 1.0 ug DNA
EUR 154
Rpap3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4819302 1.0 ug DNA
EUR 154
Rpap3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4819303 1.0 ug DNA
EUR 154
Rpap3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4819304 1.0 ug DNA
EUR 154
RPAP3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1871802 1.0 ug DNA
EUR 154
RPAP3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1871803 1.0 ug DNA
EUR 154
RPAP3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1871804 1.0 ug DNA
EUR 154
RPAP3 Protein Vector (Rat) (pPB-C-His)
PV302090 500 ng
EUR 603
RPAP3 Protein Vector (Rat) (pPB-N-His)
PV302091 500 ng
EUR 603
RPAP3 Protein Vector (Rat) (pPM-C-HA)
PV302092 500 ng
EUR 603
RPAP3 Protein Vector (Rat) (pPM-C-His)
PV302093 500 ng
EUR 603
RPAP3 Protein Vector (Human) (pPB-C-His)
PV035729 500 ng
EUR 329
RPAP3 Protein Vector (Human) (pPB-N-His)
PV035730 500 ng
EUR 329
RPAP3 Protein Vector (Human) (pPM-C-HA)
PV035731 500 ng
EUR 329
RPAP3 Protein Vector (Human) (pPM-C-His)
PV035732 500 ng
EUR 329
RPAP3 Protein Vector (Mouse) (pPB-C-His)
PV225194 500 ng
EUR 603
RPAP3 Protein Vector (Mouse) (pPB-N-His)
PV225195 500 ng
EUR 603
RPAP3 Protein Vector (Mouse) (pPM-C-HA)
PV225196 500 ng
EUR 603

RPAP3 Rabbit Polyclonal Antibody