RRBP1 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

RRBP1 Polyclonal Antibody
ABP60260-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RRBP1 protein at amino acid sequence of 1120-1200
  • Applications tips:
Description: A polyclonal antibody for detection of RRBP1 from Human, Mouse. This RRBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RRBP1 protein at amino acid sequence of 1120-1200
RRBP1 Polyclonal Antibody
ABP60260-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RRBP1 protein at amino acid sequence of 1120-1200
  • Applications tips:
Description: A polyclonal antibody for detection of RRBP1 from Human, Mouse. This RRBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RRBP1 protein at amino acid sequence of 1120-1200
RRBP1 Polyclonal Antibody
ES10185-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RRBP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
RRBP1 Polyclonal Antibody
ES10185-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RRBP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
RRBP1 Rabbit pAb
A12239-100ul 100 ul
EUR 308
RRBP1 Rabbit pAb
A12239-200ul 200 ul
EUR 459
RRBP1 Rabbit pAb
A12239-20ul 20 ul
EUR 183
RRBP1 Rabbit pAb
A12239-50ul 50 ul
EUR 223
RRBP1 Antibody
40086-100ul 100ul
EUR 252
RRBP1 Antibody
1-CSB-PA083779
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RRBP1. Recognizes RRBP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
RRBP1 antibody
70R-6733 50 ug
EUR 467
Description: Rabbit polyclonal RRBP1 antibody
Anti-RRBP1 Antibody
A07074-1 100ug/vial
EUR 334
RRBP1 Conjugated Antibody
C40086 100ul
EUR 397
Anti-RRBP1 Antibody
A1880-100
EUR 403
anti- RRBP1 antibody
FNab07491 100µg
EUR 548.75
  • Immunogen: ribosome binding protein 1 homolog 180kDa(dog)
  • Uniprot ID: Q9P2E9
  • Gene ID: 6238
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against RRBP1
Anti-RRBP1 antibody
PAab07491 100 ug
EUR 386
Anti-RRBP1 antibody
STJ114130 100 µl
EUR 277
Description: This gene encodes a ribosome-binding protein of the endoplasmic reticulum (ER) membrane. Studies suggest that this gene plays a role in ER proliferation, secretory pathways and secretory cell differentiation, and mediation of ER-microtubule interactions. Alternative splicing has been observed and protein isoforms are characterized by regions of N-terminal decapeptide and C-terminal heptad repeats. Splicing of the tandem repeats results in variations in ribosome-binding affinity and secretory function. The full-length nature of variants which differ in repeat length has not been determined. Pseudogenes of this gene have been identified on chromosomes 3 and 7, and RRBP1 has been excluded as a candidate gene in the cause of Alagille syndrome, the result of a mutation in a nearby gene on chromosome 20p12.
Anti-RRBP1 antibody
STJ191343 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RRBP1
RRBP1 siRNA
20-abx932146
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RRBP1 siRNA
20-abx932147
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RRBP1 Blocking Peptide
33R-9024 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RRBP1 antibody, catalog no. 70R-6733
Human RRBP1 Protein
20-abx650869
  • EUR 759.00
  • EUR 300.00
  • EUR 2388.00
  • EUR 913.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
RRBP1 cloning plasmid
CSB-CL879068HU-10ug 10ug
EUR 895
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2805
  • Sequence: ATGGTGGTGGTGCCCCCAGTGGGTGCCAAGGGCAACACACCAGCCACTGGCACTACTCAGGGCAAAAAGGCGGAGGGGACTCAGAATCAAAGCAAAAAGGCTGAAGGAGCCCCAAACCAGGGCAGAAAGGCAGAGGGAACCCCAAACCAGGGCAAAAAGACAGAGGGAACCCCAA
  • Show more
Description: A cloning plasmid for the RRBP1 gene.
Human RRBP1 ELISA Kit
ELA-E10807h 96 Tests
EUR 824
RRBP1 ELISA KIT|Human
EF002799 96 Tests
EUR 689
Human RRBP1 shRNA Plasmid
20-abx954201
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse RRBP1 shRNA Plasmid
20-abx979110
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Canine RRBP1 ELISA KIT
ELI-38689d 96 Tests
EUR 928
Ribosome-binding protein 1 (RRBP1) Antibody
20-abx213196
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ribosome-Binding Protein 1 (RRBP1) Antibody
20-abx126500
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ribosome-Binding Protein 1 (RRBP1) Antibody
abx030321-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ribosome-Binding Protein 1 (RRBP1) Antibody
abx030321-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ribosome-Binding Protein 1 (RRBP1) Antibody
abx237491-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
RRBP1 ORF Vector (Human) (pORF)
ORF014341 1.0 ug DNA
EUR 354
Rrbp1 ORF Vector (Mouse) (pORF)
ORF056455 1.0 ug DNA
EUR 506
Rrbp1 ORF Vector (Mouse) (pORF)
ORF056456 1.0 ug DNA
EUR 1572
RRBP1 ELISA Kit (Human) (OKEH02114)
OKEH02114 96 Wells
EUR 662
Description: Description of target: This gene encodes a ribosome-binding protein of the endoplasmic reticulum (ER) membrane. Studies suggest that this gene plays a role in ER proliferation, secretory pathways and secretory cell differentiation, and mediation of ER-microtubule interactions. Alternative splicing has been observed and protein isoforms are characterized by regions of N-terminal decapeptide and C-terminal heptad repeats. Splicing of the tandem repeats results in variations in ribosome-binding affinity and secretory function. The full-length nature of variants which differ in repeat length has not been determined. Pseudogenes of this gene have been identified on chromosomes 3 and 7, and RRBP1 has been excluded as a candidate gene in the cause of Alagille syndrome, the result of a mutation in a nearby gene on chromosome 20p12.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34 pg/mL
RRBP1 ELISA Kit (Dog) (OKEH07655)
OKEH07655 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
Rrbp1 sgRNA CRISPR Lentivector set (Mouse)
K4627501 3 x 1.0 ug
EUR 339
RRBP1 sgRNA CRISPR Lentivector set (Human)
K2070701 3 x 1.0 ug
EUR 339
Recombinant Ribosome Binding Protein 1 (RRBP1)
4-RPC770Hu01
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9P2E9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.1kDa
  • Isoelectric Point: 4.7
Description: Recombinant Human Ribosome Binding Protein 1 expressed in: E.coli
Rrbp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4627502 1.0 ug DNA
EUR 154
Rrbp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4627503 1.0 ug DNA
EUR 154
Rrbp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4627504 1.0 ug DNA
EUR 154
RRBP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2070702 1.0 ug DNA
EUR 154
RRBP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2070703 1.0 ug DNA
EUR 154
RRBP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2070704 1.0 ug DNA
EUR 154
RRBP1 Protein Vector (Human) (pPB-C-His)
PV057361 500 ng
EUR 481
RRBP1 Protein Vector (Human) (pPB-N-His)
PV057362 500 ng
EUR 481
RRBP1 Protein Vector (Human) (pPM-C-HA)
PV057363 500 ng
EUR 481
RRBP1 Protein Vector (Human) (pPM-C-His)
PV057364 500 ng
EUR 481
RRBP1 Protein Vector (Mouse) (pPB-C-His)
PV225818 500 ng
EUR 1065
RRBP1 Protein Vector (Mouse) (pPB-N-His)
PV225819 500 ng
EUR 1065
RRBP1 Protein Vector (Mouse) (pPM-C-HA)
PV225820 500 ng
EUR 1065
RRBP1 Protein Vector (Mouse) (pPM-C-His)
PV225821 500 ng
EUR 1065
RRBP1 Protein Vector (Mouse) (pPB-C-His)
PV225822 500 ng
EUR 2483
RRBP1 Protein Vector (Mouse) (pPB-N-His)
PV225823 500 ng
EUR 2483
RRBP1 Protein Vector (Mouse) (pPM-C-HA)
PV225824 500 ng
EUR 2483
RRBP1 Protein Vector (Mouse) (pPM-C-His)
PV225825 500 ng
EUR 2483
Rrbp1 3'UTR Luciferase Stable Cell Line
TU118190 1.0 ml Ask for price
Rrbp1 3'UTR GFP Stable Cell Line
TU168190 1.0 ml Ask for price
Rrbp1 3'UTR Luciferase Stable Cell Line
TU219732 1.0 ml Ask for price
Rrbp1 3'UTR GFP Stable Cell Line
TU269732 1.0 ml Ask for price
RRBP1 3'UTR GFP Stable Cell Line
TU072388 1.0 ml
EUR 1394
RRBP1 3'UTR Luciferase Stable Cell Line
TU022388 1.0 ml
EUR 1394
Human Ribosome-binding protein 1 (RRBP1) ELISA Kit
abx250471-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Rrbp1/ Ribosome-binding protein 1 ELISA Kit
E1673Mo 1 Kit
EUR 632
Human RRBP1/ Ribosome-binding protein 1 ELISA Kit
E2178Hu 1 Kit
EUR 605
Human RRBP1(Ribosome-binding protein 1) ELISA Kit
EH1215 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q9P2E9
  • Alias: RRBP1/Ribosome-binding protein 1/Ribosome receptor protein/180 kDa ribosome receptor homolog/RRp
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml
Mouse Ribosome- binding protein 1, Rrbp1 ELISA KIT
ELI-15196m 96 Tests
EUR 865
Human Ribosome- binding protein 1, RRBP1 ELISA KIT
ELI-18387h 96 Tests
EUR 824

RRBP1 Rabbit Polyclonal Antibody