RRBP1 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
RRBP1 Polyclonal Antibody |
ABP60260-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RRBP1 protein at amino acid sequence of 1120-1200
- Applications tips:
|
Description: A polyclonal antibody for detection of RRBP1 from Human, Mouse. This RRBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RRBP1 protein at amino acid sequence of 1120-1200 |
RRBP1 Polyclonal Antibody |
ABP60260-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RRBP1 protein at amino acid sequence of 1120-1200
- Applications tips:
|
Description: A polyclonal antibody for detection of RRBP1 from Human, Mouse. This RRBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RRBP1 protein at amino acid sequence of 1120-1200 |
RRBP1 Polyclonal Antibody |
ES10185-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RRBP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RRBP1 Polyclonal Antibody |
ES10185-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RRBP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RRBP1 Rabbit pAb |
A12239-100ul |
Abclonal |
100 ul |
EUR 308 |
RRBP1 Rabbit pAb |
A12239-200ul |
Abclonal |
200 ul |
EUR 459 |
RRBP1 Rabbit pAb |
A12239-20ul |
Abclonal |
20 ul |
EUR 183 |
RRBP1 Rabbit pAb |
A12239-50ul |
Abclonal |
50 ul |
EUR 223 |
RRBP1 Antibody |
40086-100ul |
SAB |
100ul |
EUR 252 |
RRBP1 Antibody |
1-CSB-PA083779 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RRBP1. Recognizes RRBP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
RRBP1 antibody |
70R-6733 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RRBP1 antibody |
Anti-RRBP1 Antibody |
A07074-1 |
BosterBio |
100ug/vial |
EUR 334 |
RRBP1 Conjugated Antibody |
C40086 |
SAB |
100ul |
EUR 397 |
Anti-RRBP1 Antibody |
A1880-100 |
Biovision |
|
EUR 403 |
anti- RRBP1 antibody |
FNab07491 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: ribosome binding protein 1 homolog 180kDa(dog)
- Uniprot ID: Q9P2E9
- Gene ID: 6238
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against RRBP1 |
Anti-RRBP1 antibody |
STJ114130 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a ribosome-binding protein of the endoplasmic reticulum (ER) membrane. Studies suggest that this gene plays a role in ER proliferation, secretory pathways and secretory cell differentiation, and mediation of ER-microtubule interactions. Alternative splicing has been observed and protein isoforms are characterized by regions of N-terminal decapeptide and C-terminal heptad repeats. Splicing of the tandem repeats results in variations in ribosome-binding affinity and secretory function. The full-length nature of variants which differ in repeat length has not been determined. Pseudogenes of this gene have been identified on chromosomes 3 and 7, and RRBP1 has been excluded as a candidate gene in the cause of Alagille syndrome, the result of a mutation in a nearby gene on chromosome 20p12. |
Anti-RRBP1 antibody |
STJ191343 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RRBP1 |
RRBP1 siRNA |
20-abx932146 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RRBP1 siRNA |
20-abx932147 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RRBP1 Blocking Peptide |
33R-9024 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RRBP1 antibody, catalog no. 70R-6733 |
Human RRBP1 Protein |
20-abx650869 |
Abbexa |
-
EUR 759.00
-
EUR 300.00
-
EUR 2388.00
-
EUR 913.00
-
EUR 537.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
RRBP1 cloning plasmid |
CSB-CL879068HU-10ug |
Cusabio |
10ug |
EUR 895 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2805
- Sequence: ATGGTGGTGGTGCCCCCAGTGGGTGCCAAGGGCAACACACCAGCCACTGGCACTACTCAGGGCAAAAAGGCGGAGGGGACTCAGAATCAAAGCAAAAAGGCTGAAGGAGCCCCAAACCAGGGCAGAAAGGCAGAGGGAACCCCAAACCAGGGCAAAAAGACAGAGGGAACCCCAA
- Show more
|
Description: A cloning plasmid for the RRBP1 gene. |
Human RRBP1 shRNA Plasmid |
20-abx954201 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse RRBP1 shRNA Plasmid |
20-abx979110 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Ribosome-binding protein 1 (RRBP1) Antibody |
20-abx213196 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ribosome-Binding Protein 1 (RRBP1) Antibody |
20-abx126500 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Ribosome-Binding Protein 1 (RRBP1) Antibody |
abx030321-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Ribosome-Binding Protein 1 (RRBP1) Antibody |
abx030321-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Ribosome-Binding Protein 1 (RRBP1) Antibody |
abx237491-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
RRBP1 ORF Vector (Human) (pORF) |
ORF014341 |
ABM |
1.0 ug DNA |
EUR 354 |
Rrbp1 ORF Vector (Mouse) (pORF) |
ORF056455 |
ABM |
1.0 ug DNA |
EUR 506 |
Rrbp1 ORF Vector (Mouse) (pORF) |
ORF056456 |
ABM |
1.0 ug DNA |
EUR 1572 |
RRBP1 ELISA Kit (Human) (OKEH02114) |
OKEH02114 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene encodes a ribosome-binding protein of the endoplasmic reticulum (ER) membrane. Studies suggest that this gene plays a role in ER proliferation, secretory pathways and secretory cell differentiation, and mediation of ER-microtubule interactions. Alternative splicing has been observed and protein isoforms are characterized by regions of N-terminal decapeptide and C-terminal heptad repeats. Splicing of the tandem repeats results in variations in ribosome-binding affinity and secretory function. The full-length nature of variants which differ in repeat length has not been determined. Pseudogenes of this gene have been identified on chromosomes 3 and 7, and RRBP1 has been excluded as a candidate gene in the cause of Alagille syndrome, the result of a mutation in a nearby gene on chromosome 20p12.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34 pg/mL |
RRBP1 ELISA Kit (Dog) (OKEH07655) |
OKEH07655 |
Aviva Systems Biology |
96 Wells |
EUR 1184 |
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
Rrbp1 sgRNA CRISPR Lentivector set (Mouse) |
K4627501 |
ABM |
3 x 1.0 ug |
EUR 339 |
RRBP1 sgRNA CRISPR Lentivector set (Human) |
K2070701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Ribosome Binding Protein 1 (RRBP1) |
4-RPC770Hu01 |
Cloud-Clone |
-
EUR 548.00
-
EUR 250.00
-
EUR 1780.00
-
EUR 660.00
-
EUR 1220.00
-
EUR 430.00
-
EUR 4300.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9P2E9
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 21.1kDa
- Isoelectric Point: 4.7
|
Description: Recombinant Human Ribosome Binding Protein 1 expressed in: E.coli |
Rrbp1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4627502 |
ABM |
1.0 ug DNA |
EUR 154 |
Rrbp1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4627503 |
ABM |
1.0 ug DNA |
EUR 154 |
Rrbp1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4627504 |
ABM |
1.0 ug DNA |
EUR 154 |
RRBP1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2070702 |
ABM |
1.0 ug DNA |
EUR 154 |
RRBP1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2070703 |
ABM |
1.0 ug DNA |
EUR 154 |
RRBP1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2070704 |
ABM |
1.0 ug DNA |
EUR 154 |
RRBP1 Protein Vector (Human) (pPB-C-His) |
PV057361 |
ABM |
500 ng |
EUR 481 |
RRBP1 Protein Vector (Human) (pPB-N-His) |
PV057362 |
ABM |
500 ng |
EUR 481 |
RRBP1 Protein Vector (Human) (pPM-C-HA) |
PV057363 |
ABM |
500 ng |
EUR 481 |
RRBP1 Protein Vector (Human) (pPM-C-His) |
PV057364 |
ABM |
500 ng |
EUR 481 |
RRBP1 Protein Vector (Mouse) (pPB-C-His) |
PV225818 |
ABM |
500 ng |
EUR 1065 |
RRBP1 Protein Vector (Mouse) (pPB-N-His) |
PV225819 |
ABM |
500 ng |
EUR 1065 |
RRBP1 Protein Vector (Mouse) (pPM-C-HA) |
PV225820 |
ABM |
500 ng |
EUR 1065 |
RRBP1 Protein Vector (Mouse) (pPM-C-His) |
PV225821 |
ABM |
500 ng |
EUR 1065 |
RRBP1 Protein Vector (Mouse) (pPB-C-His) |
PV225822 |
ABM |
500 ng |
EUR 2483 |
RRBP1 Protein Vector (Mouse) (pPB-N-His) |
PV225823 |
ABM |
500 ng |
EUR 2483 |
RRBP1 Protein Vector (Mouse) (pPM-C-HA) |
PV225824 |
ABM |
500 ng |
EUR 2483 |
RRBP1 Protein Vector (Mouse) (pPM-C-His) |
PV225825 |
ABM |
500 ng |
EUR 2483 |
Rrbp1 3'UTR Luciferase Stable Cell Line |
TU118190 |
ABM |
1.0 ml |
Ask for price |
Rrbp1 3'UTR GFP Stable Cell Line |
TU168190 |
ABM |
1.0 ml |
Ask for price |
Rrbp1 3'UTR Luciferase Stable Cell Line |
TU219732 |
ABM |
1.0 ml |
Ask for price |
Rrbp1 3'UTR GFP Stable Cell Line |
TU269732 |
ABM |
1.0 ml |
Ask for price |
RRBP1 3'UTR GFP Stable Cell Line |
TU072388 |
ABM |
1.0 ml |
EUR 1394 |
RRBP1 3'UTR Luciferase Stable Cell Line |
TU022388 |
ABM |
1.0 ml |
EUR 1394 |
Human Ribosome-binding protein 1 (RRBP1) ELISA Kit |
abx250471-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Rrbp1/ Ribosome-binding protein 1 ELISA Kit |
E1673Mo |
Sunlong |
1 Kit |
EUR 632 |
Human RRBP1/ Ribosome-binding protein 1 ELISA Kit |
E2178Hu |
Sunlong |
1 Kit |
EUR 605 |
Human RRBP1(Ribosome-binding protein 1) ELISA Kit |
EH1215 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: Q9P2E9
- Alias: RRBP1/Ribosome-binding protein 1/Ribosome receptor protein/180 kDa ribosome receptor homolog/RRp
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml |
Mouse Ribosome- binding protein 1, Rrbp1 ELISA KIT |
ELI-15196m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Ribosome- binding protein 1, RRBP1 ELISA KIT |
ELI-18387h |
Lifescience Market |
96 Tests |
EUR 824 |
RRBP1 Rabbit Polyclonal Antibody