RRBP1 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

RRBP1 Polyclonal Antibody
ABP60260-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human RRBP1 protein at amino acid sequence of 1120-1200 Applications tips:
Description: A polyclonal antibody for detection of RRBP1 from Human, Mouse. This RRBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RRBP1 protein at amino acid sequence of 1120-1200

RRBP1 Polyclonal Antibody
ABP60260-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RRBP1 protein at amino acid sequence of 1120-1200 Applications tips:
Description: A polyclonal antibody for detection of RRBP1 from Human, Mouse. This RRBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RRBP1 protein at amino acid sequence of 1120-1200

RRBP1 Polyclonal Antibody
ES10185-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RRBP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RRBP1 Polyclonal Antibody
ES10185-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RRBP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RRBP1 Rabbit pAb
A12239-100ul	Abclonal	100 ul	EUR 308

RRBP1 Rabbit pAb
A12239-200ul	Abclonal	200 ul	EUR 459

RRBP1 Rabbit pAb
A12239-20ul	Abclonal	20 ul	EUR 183

RRBP1 Rabbit pAb
A12239-50ul	Abclonal	50 ul	EUR 223

RRBP1 Antibody
40086-100ul	SAB	100ul	EUR 252

RRBP1 Antibody
1-CSB-PA083779	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RRBP1. Recognizes RRBP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RRBP1 antibody
70R-6733	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RRBP1 antibody

Anti-RRBP1 Antibody
A07074-1	BosterBio	100ug/vial	EUR 334

RRBP1 Conjugated Antibody
C40086	SAB	100ul	EUR 397

Anti-RRBP1 Antibody
A1880-100	Biovision		EUR 403

anti- RRBP1 antibody
FNab07491	FN Test	100µg	EUR 548.75
Immunogen: ribosome binding protein 1 homolog 180kDa(dog) Uniprot ID: Q9P2E9 Gene ID: 6238 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against RRBP1

Anti-RRBP1 antibody
PAab07491	Lifescience Market	100 ug	EUR 386

Anti-RRBP1 antibody
STJ114130	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a ribosome-binding protein of the endoplasmic reticulum (ER) membrane. Studies suggest that this gene plays a role in ER proliferation, secretory pathways and secretory cell differentiation, and mediation of ER-microtubule interactions. Alternative splicing has been observed and protein isoforms are characterized by regions of N-terminal decapeptide and C-terminal heptad repeats. Splicing of the tandem repeats results in variations in ribosome-binding affinity and secretory function. The full-length nature of variants which differ in repeat length has not been determined. Pseudogenes of this gene have been identified on chromosomes 3 and 7, and RRBP1 has been excluded as a candidate gene in the cause of Alagille syndrome, the result of a mutation in a nearby gene on chromosome 20p12.

Anti-RRBP1 antibody
STJ191343	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RRBP1

RRBP1 siRNA
20-abx932146	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RRBP1 siRNA
20-abx932147	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RRBP1 Blocking Peptide
33R-9024	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RRBP1 antibody, catalog no. 70R-6733

Human RRBP1 Protein
20-abx650869	Abbexa	EUR 759.00 EUR 300.00 EUR 2388.00 EUR 913.00 EUR 537.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

RRBP1 cloning plasmid
CSB-CL879068HU-10ug	Cusabio	10ug	EUR 895
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2805 Sequence: ATGGTGGTGGTGCCCCCAGTGGGTGCCAAGGGCAACACACCAGCCACTGGCACTACTCAGGGCAAAAAGGCGGAGGGGACTCAGAATCAAAGCAAAAAGGCTGAAGGAGCCCCAAACCAGGGCAGAAAGGCAGAGGGAACCCCAAACCAGGGCAAAAAGACAGAGGGAACCCCAA Show more
Description: A cloning plasmid for the RRBP1 gene.

Human RRBP1 ELISA Kit
ELA-E10807h	Lifescience Market	96 Tests	EUR 824

RRBP1 ELISA KIT|Human
EF002799	Lifescience Market	96 Tests	EUR 689

Human RRBP1 shRNA Plasmid
20-abx954201	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RRBP1 shRNA Plasmid
20-abx979110	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Canine RRBP1 ELISA KIT
ELI-38689d	Lifescience Market	96 Tests	EUR 928

Ribosome-binding protein 1 (RRBP1) Antibody
20-abx213196	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Ribosome-Binding Protein 1 (RRBP1) Antibody
20-abx126500	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Ribosome-Binding Protein 1 (RRBP1) Antibody
abx030321-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ribosome-Binding Protein 1 (RRBP1) Antibody
abx030321-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Ribosome-Binding Protein 1 (RRBP1) Antibody
abx237491-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

RRBP1 ORF Vector (Human) (pORF)
ORF014341	ABM	1.0 ug DNA	EUR 354

Rrbp1 ORF Vector (Mouse) (pORF)
ORF056455	ABM	1.0 ug DNA	EUR 506

Rrbp1 ORF Vector (Mouse) (pORF)
ORF056456	ABM	1.0 ug DNA	EUR 1572

RRBP1 ELISA Kit (Human) (OKEH02114)
OKEH02114	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a ribosome-binding protein of the endoplasmic reticulum (ER) membrane. Studies suggest that this gene plays a role in ER proliferation, secretory pathways and secretory cell differentiation, and mediation of ER-microtubule interactions. Alternative splicing has been observed and protein isoforms are characterized by regions of N-terminal decapeptide and C-terminal heptad repeats. Splicing of the tandem repeats results in variations in ribosome-binding affinity and secretory function. The full-length nature of variants which differ in repeat length has not been determined. Pseudogenes of this gene have been identified on chromosomes 3 and 7, and RRBP1 has been excluded as a candidate gene in the cause of Alagille syndrome, the result of a mutation in a nearby gene on chromosome 20p12.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34 pg/mL

RRBP1 ELISA Kit (Dog) (OKEH07655)
OKEH07655	Aviva Systems Biology	96 Wells	EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Rrbp1 sgRNA CRISPR Lentivector set (Mouse)
K4627501	ABM	3 x 1.0 ug	EUR 339

RRBP1 sgRNA CRISPR Lentivector set (Human)
K2070701	ABM	3 x 1.0 ug	EUR 339

Recombinant Ribosome Binding Protein 1 (RRBP1)
4-RPC770Hu01	Cloud-Clone	EUR 548.00 EUR 250.00 EUR 1780.00 EUR 660.00 EUR 1220.00 EUR 430.00 EUR 4300.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9P2E9 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 21.1kDa Isoelectric Point: 4.7
Description: Recombinant Human Ribosome Binding Protein 1 expressed in: E.coli

Rrbp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4627502	ABM	1.0 ug DNA	EUR 154

Rrbp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4627503	ABM	1.0 ug DNA	EUR 154

Rrbp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4627504	ABM	1.0 ug DNA	EUR 154

RRBP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2070702	ABM	1.0 ug DNA	EUR 154

RRBP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2070703	ABM	1.0 ug DNA	EUR 154

RRBP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2070704	ABM	1.0 ug DNA	EUR 154

RRBP1 Protein Vector (Human) (pPB-C-His)
PV057361	ABM	500 ng	EUR 481

RRBP1 Protein Vector (Human) (pPB-N-His)
PV057362	ABM	500 ng	EUR 481

RRBP1 Protein Vector (Human) (pPM-C-HA)
PV057363	ABM	500 ng	EUR 481

RRBP1 Protein Vector (Human) (pPM-C-His)
PV057364	ABM	500 ng	EUR 481

RRBP1 Protein Vector (Mouse) (pPB-C-His)
PV225818	ABM	500 ng	EUR 1065

RRBP1 Protein Vector (Mouse) (pPB-N-His)
PV225819	ABM	500 ng	EUR 1065

RRBP1 Protein Vector (Mouse) (pPM-C-HA)
PV225820	ABM	500 ng	EUR 1065

RRBP1 Protein Vector (Mouse) (pPM-C-His)
PV225821	ABM	500 ng	EUR 1065

RRBP1 Protein Vector (Mouse) (pPB-C-His)
PV225822	ABM	500 ng	EUR 2483

RRBP1 Protein Vector (Mouse) (pPB-N-His)
PV225823	ABM	500 ng	EUR 2483

RRBP1 Protein Vector (Mouse) (pPM-C-HA)
PV225824	ABM	500 ng	EUR 2483

RRBP1 Protein Vector (Mouse) (pPM-C-His)
PV225825	ABM	500 ng	EUR 2483

Rrbp1 3'UTR Luciferase Stable Cell Line
TU118190	ABM	1.0 ml	Ask for price

Rrbp1 3'UTR GFP Stable Cell Line
TU168190	ABM	1.0 ml	Ask for price

Rrbp1 3'UTR Luciferase Stable Cell Line
TU219732	ABM	1.0 ml	Ask for price

Rrbp1 3'UTR GFP Stable Cell Line
TU269732	ABM	1.0 ml	Ask for price

RRBP1 3'UTR GFP Stable Cell Line
TU072388	ABM	1.0 ml	EUR 1394

RRBP1 3'UTR Luciferase Stable Cell Line
TU022388	ABM	1.0 ml	EUR 1394

Human Ribosome-binding protein 1 (RRBP1) ELISA Kit
abx250471-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Rrbp1/ Ribosome-binding protein 1 ELISA Kit
E1673Mo	Sunlong	1 Kit	EUR 632

Human RRBP1/ Ribosome-binding protein 1 ELISA Kit
E2178Hu	Sunlong	1 Kit	EUR 605

Human RRBP1(Ribosome-binding protein 1) ELISA Kit
EH1215	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: Q9P2E9 Alias: RRBP1/Ribosome-binding protein 1/Ribosome receptor protein/180 kDa ribosome receptor homolog/RRp
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Mouse Ribosome- binding protein 1, Rrbp1 ELISA KIT
ELI-15196m	Lifescience Market	96 Tests	EUR 865

Human Ribosome- binding protein 1, RRBP1 ELISA KIT
ELI-18387h	Lifescience Market	96 Tests	EUR 824

RRBP1 Rabbit Polyclonal Antibody