Single-Cell Transcriptomics of Immune Cells

In-Yeast Assembly of Coronavirus Infectious cDNA Clones Using a Synthetic Genomics Pipeline


The Escherichia coli and vaccinia virus-based reverse genetics strategies have been broadly utilized for the manipulation and engineering of coronavirus genomes. These strategies, nonetheless, present a variety of limitations and are typically robust to find out in a properly timed technique for (re-)rising viruses. On this chapter, we present a model new widespread reverse genetics platform for the assembly and engineering of infectious full-length cDNAs using yeast-based transformation-associated recombination cloning.


This novel assembly method not solely ends in safe coronavirus infectious full-length cDNAs cloned inside the yeast Saccharomyces cerevisiae however moreover fosters and accelerates the manipulation of their genomes.


Such a platform is broadly related for the scientific neighborhood, as a result of it requires no explicit gear and may very well be carried out in an strange laboratory setting. The protocol described may very well be merely tailor-made to only about all acknowledged or rising coronaviruses, harking back to Heart East respiratory syndrome coronavirus (MERS-CoV).


cDNA from Monkey (Rhesus) Normal Tissue: Brain
C1534035 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Cecum
C1534089 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Colon
C1534090 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Epididymis
C1534105 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Esophagus
C1534106 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Gallbladder
C1534118 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Heart
C1534122 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Kidney
C1534142 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Liver
C1534149 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Lung
C1534152 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Trachea
C1534160 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Diaphragm
C1534169 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Ovary
C1534183 40 reactions
EUR 939
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Pancreas
C1534188 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Parathyroid
C1534189 40 reactions
EUR 1051
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Parotid
C1534190 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Penis
C1534194 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Placenta
C1534200 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Prostate
C1534201 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Rectum
C1534206 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Skin
C1534218 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Spleen
C1534246 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Stomach
C1534248 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Testis
C1534260 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Throat
C1534263 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Thymus
C1534264 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Thyroid
C1534265 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Tongue
C1534267 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Tonsil
C1534268 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Ureter
C1534273 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Uterus
C1534274 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Vagina
C1534283 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Colon Ascending
C1534091 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Colon descending
C1534092 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Colon Sigmoid
C1534095 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Colon Transverse
C1534096 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Ductus Deferens
C1534100 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Fallopian Tube
C1534115 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Heart: Pericardium
C1534133 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Lymph Node
C1534161 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Skeletal Muscle
C1534171 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Small Intestine
C1534226 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Spinal Cord
C1534234 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Stomach: Cardia
C1534250 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Stomach: Corpus
C1534251 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Stomach: Fundus
C1534252 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Stomach: Pylorus
C1534253 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Cervix
C1534275 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Corpus
C1534276 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Fundus
C1534278 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Blood Vessel: Artery
C1534013 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Blood Vessel: Vein
C1534020 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Small Intestine: Duodenum
C1534101 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Liver: Left Lobe
C1534150 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Liver: Right Lobe
C1534151 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Small Intestine: Ileum
C1534227 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Small Intestine: Jejunum
C1534230 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
SAA1, monkey (rhesus macaque)
RC326-12 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Other
Immunoglobulin A (IgA) Polyclonal Antibody (Rhesus monkey)
  • EUR 310.00
  • EUR 3500.00
  • EUR 850.00
  • EUR 400.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Immunoglobulin A (IgA)
Cathepsin K (CTSK) Monoclonal Antibody (Rhesus monkey)
  • EUR 278.00
  • EUR 3011.00
  • EUR 739.00
  • EUR 355.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Pro116~Met329
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Cathepsin K (CTSK)
Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey)
  • EUR 270.00
  • EUR 2879.00
  • EUR 709.00
  • EUR 343.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa)
Cyclophilin A (CYPA) Polyclonal Antibody (Rhesus monkey)
  • EUR 270.00
  • EUR 2879.00
  • EUR 709.00
  • EUR 343.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYPA (Val2~Glu165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Cyclophilin A (CYPA)
Interleukin 5 (IL5) Polyclonal Antibody (Rhesus monkey)
  • EUR 269.00
  • EUR 2866.00
  • EUR 706.00
  • EUR 342.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL5 (Ile20~Ser134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 5 (IL5)
Interleukin 6 (IL6) Polyclonal Antibody (Rhesus monkey)
  • EUR 270.00
  • EUR 2879.00
  • EUR 709.00
  • EUR 343.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6 (Pro27~Met212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 6 (IL6)
Interleukin 8 (IL8) Polyclonal Antibody (Rhesus monkey)
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL8 (Ala23~Pro101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 8 (IL8)
Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey)
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ala23~Pro101
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8)
Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey)
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8)
Monkey CD4 ELISA Kit
EMKC0011 96Tests
EUR 521
Monoclonal CD4 Antibody (clone 5D9), Clone: 5D9
AMM02279G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human CD4 (clone 5D9). The antibodies are raised in Mouse and are from clone 5D9. This antibody is applicable in WB and IHC-P
Immunoglobulin A (IgA) Polyclonal Antibody (Rhesus monkey), APC
  • EUR 440.00
  • EUR 4625.00
  • EUR 1250.00
  • EUR 575.00
  • EUR 260.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Immunoglobulin A (IgA). This antibody is labeled with APC.
Immunoglobulin A (IgA) Polyclonal Antibody (Rhesus monkey), Biotinylated
  • EUR 381.00
  • EUR 3450.00
  • EUR 975.00
  • EUR 480.00
  • EUR 249.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Immunoglobulin A (IgA). This antibody is labeled with Biotin.
Immunoglobulin A (IgA) Polyclonal Antibody (Rhesus monkey), Cy3
  • EUR 545.00
  • EUR 6125.00
  • EUR 1625.00
  • EUR 725.00
  • EUR 305.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Immunoglobulin A (IgA). This antibody is labeled with Cy3.
Immunoglobulin A (IgA) Polyclonal Antibody (Rhesus monkey), FITC
  • EUR 372.00
  • EUR 3720.00
  • EUR 1020.00
  • EUR 480.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Immunoglobulin A (IgA). This antibody is labeled with FITC.
Immunoglobulin A (IgA) Polyclonal Antibody (Rhesus monkey), HRP
  • EUR 398.00
  • EUR 4025.00
  • EUR 1100.00
  • EUR 515.00
  • EUR 242.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Immunoglobulin A (IgA). This antibody is labeled with HRP.
Immunoglobulin A (IgA) Polyclonal Antibody (Rhesus monkey), PE
  • EUR 372.00
  • EUR 3720.00
  • EUR 1020.00
  • EUR 480.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Immunoglobulin A (IgA). This antibody is labeled with PE.
Hemoglobin (HB) Polyclonal Antibody (Human, Rhesus monkey, Dog)
  • EUR 280.00
  • EUR 3024.00
  • EUR 742.00
  • EUR 356.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Native Protein Hemoglobin
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rhesus monkey, Dog Hemoglobin (HB)
Carbonic Anhydrase II (CA2) Monoclonal Antibody (Rhesus monkey)
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Carbonic Anhydrase II (CA2)
Cathepsin K (CTSK) Monoclonal Antibody (Rhesus monkey), APC
  • EUR 393.00
  • EUR 3959.00
  • EUR 1083.00
  • EUR 508.00
  • EUR 240.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Pro116~Met329
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Cathepsin K (CTSK). This antibody is labeled with APC.
Cathepsin K (CTSK) Monoclonal Antibody (Rhesus monkey), Biotinylated
  • EUR 346.00
  • EUR 2961.00
  • EUR 852.00
  • EUR 431.00
  • EUR 234.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Pro116~Met329
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Cathepsin K (CTSK). This antibody is labeled with Biotin.
Cathepsin K (CTSK) Monoclonal Antibody (Rhesus monkey), Cy3
  • EUR 482.00
  • EUR 5237.00
  • EUR 1403.00
  • EUR 636.00
  • EUR 278.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Pro116~Met329
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Cathepsin K (CTSK). This antibody is labeled with Cy3.
Cathepsin K (CTSK) Monoclonal Antibody (Rhesus monkey), FITC
  • EUR 334.00
  • EUR 3187.00
  • EUR 886.00
  • EUR 426.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Pro116~Met329
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Cathepsin K (CTSK). This antibody is labeled with FITC.
Cathepsin K (CTSK) Monoclonal Antibody (Rhesus monkey), HRP
  • EUR 357.00
  • EUR 3447.00
  • EUR 955.00
  • EUR 457.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Pro116~Met329
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Cathepsin K (CTSK). This antibody is labeled with HRP.
Cathepsin K (CTSK) Monoclonal Antibody (Rhesus monkey), PE
  • EUR 334.00
  • EUR 3187.00
  • EUR 886.00
  • EUR 426.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Pro116~Met329
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Cathepsin K (CTSK). This antibody is labeled with PE.
Glycated Hemoglobin A1c (HbA1c) Polyclonal Antibody (Rhesus monkey)
  • EUR 269.00
  • EUR 2866.00
  • EUR 706.00
  • EUR 342.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Native Protein
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Glycated Hemoglobin A1c (HbA1c)
Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), APC
  • EUR 380.00
  • EUR 3779.00
  • EUR 1038.00
  • EUR 490.00
  • EUR 234.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with APC.
Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), Biotinylated
  • EUR 337.00
  • EUR 2829.00
  • EUR 819.00
  • EUR 417.00
  • EUR 230.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with Biotin.
Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), Cy3
  • EUR 465.00
  • EUR 4997.00
  • EUR 1343.00
  • EUR 612.00
  • EUR 271.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with Cy3.
Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), FITC
  • EUR 324.00
  • EUR 3043.00
  • EUR 850.00
  • EUR 412.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with FITC.
Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), HRP
  • EUR 346.00
  • EUR 3291.00
  • EUR 916.00
  • EUR 441.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with HRP.
Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), PE
  • EUR 324.00
  • EUR 3043.00
  • EUR 850.00
  • EUR 412.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with PE.
Cyclophilin A (CYPA) Polyclonal Antibody (Rhesus monkey), APC
  • EUR 380.00
  • EUR 3779.00
  • EUR 1038.00
  • EUR 490.00
  • EUR 234.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYPA (Val2~Glu165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Cyclophilin A (CYPA). This antibody is labeled with APC.
Cyclophilin A (CYPA) Polyclonal Antibody (Rhesus monkey), Biotinylated
  • EUR 337.00
  • EUR 2829.00
  • EUR 819.00
  • EUR 417.00
  • EUR 230.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYPA (Val2~Glu165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Cyclophilin A (CYPA). This antibody is labeled with Biotin.
Cyclophilin A (CYPA) Polyclonal Antibody (Rhesus monkey), Cy3
  • EUR 465.00
  • EUR 4997.00
  • EUR 1343.00
  • EUR 612.00
  • EUR 271.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYPA (Val2~Glu165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Cyclophilin A (CYPA). This antibody is labeled with Cy3.
Cyclophilin A (CYPA) Polyclonal Antibody (Rhesus monkey), FITC
  • EUR 324.00
  • EUR 3043.00
  • EUR 850.00
  • EUR 412.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYPA (Val2~Glu165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Cyclophilin A (CYPA). This antibody is labeled with FITC.
Cyclophilin A (CYPA) Polyclonal Antibody (Rhesus monkey), HRP
  • EUR 346.00
  • EUR 3291.00
  • EUR 916.00
  • EUR 441.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYPA (Val2~Glu165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Cyclophilin A (CYPA). This antibody is labeled with HRP.
Cyclophilin A (CYPA) Polyclonal Antibody (Rhesus monkey), PE
  • EUR 324.00
  • EUR 3043.00
  • EUR 850.00
  • EUR 412.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYPA (Val2~Glu165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Cyclophilin A (CYPA). This antibody is labeled with PE.
Interleukin 5 (IL5) Polyclonal Antibody (Rhesus monkey), APC
  • EUR 379.00
  • EUR 3761.00
  • EUR 1034.00
  • EUR 488.00
  • EUR 233.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL5 (Ile20~Ser134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 5 (IL5). This antibody is labeled with APC.
Interleukin 5 (IL5) Polyclonal Antibody (Rhesus monkey), Biotinylated
  • EUR 336.00
  • EUR 2816.00
  • EUR 816.00
  • EUR 416.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL5 (Ile20~Ser134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 5 (IL5). This antibody is labeled with Biotin.
Interleukin 5 (IL5) Polyclonal Antibody (Rhesus monkey), Cy3
  • EUR 464.00
  • EUR 4973.00
  • EUR 1337.00
  • EUR 609.00
  • EUR 270.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL5 (Ile20~Ser134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 5 (IL5). This antibody is labeled with Cy3.
Interleukin 5 (IL5) Polyclonal Antibody (Rhesus monkey), FITC
  • EUR 323.00
  • EUR 3028.00
  • EUR 847.00
  • EUR 410.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL5 (Ile20~Ser134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 5 (IL5). This antibody is labeled with FITC.
Interleukin 5 (IL5) Polyclonal Antibody (Rhesus monkey), HRP
  • EUR 345.00
  • EUR 3276.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL5 (Ile20~Ser134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 5 (IL5). This antibody is labeled with HRP.
Interleukin 5 (IL5) Polyclonal Antibody (Rhesus monkey), PE
  • EUR 323.00
  • EUR 3028.00
  • EUR 847.00
  • EUR 410.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL5 (Ile20~Ser134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 5 (IL5). This antibody is labeled with PE.
Interleukin 6 (IL6) Polyclonal Antibody (Rhesus monkey), APC
  • EUR 380.00
  • EUR 3779.00
  • EUR 1038.00
  • EUR 490.00
  • EUR 234.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6 (Pro27~Met212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 6 (IL6). This antibody is labeled with APC.
Interleukin 6 (IL6) Polyclonal Antibody (Rhesus monkey), Biotinylated
  • EUR 337.00
  • EUR 2829.00
  • EUR 819.00
  • EUR 417.00
  • EUR 230.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6 (Pro27~Met212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 6 (IL6). This antibody is labeled with Biotin.
Interleukin 6 (IL6) Polyclonal Antibody (Rhesus monkey), Cy3
  • EUR 465.00
  • EUR 4997.00
  • EUR 1343.00
  • EUR 612.00
  • EUR 271.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6 (Pro27~Met212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 6 (IL6). This antibody is labeled with Cy3.
Interleukin 6 (IL6) Polyclonal Antibody (Rhesus monkey), FITC
  • EUR 324.00
  • EUR 3043.00
  • EUR 850.00
  • EUR 412.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6 (Pro27~Met212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 6 (IL6). This antibody is labeled with FITC.
Interleukin 6 (IL6) Polyclonal Antibody (Rhesus monkey), HRP
  • EUR 346.00
  • EUR 3291.00
  • EUR 916.00
  • EUR 441.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6 (Pro27~Met212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 6 (IL6). This antibody is labeled with HRP.
Interleukin 6 (IL6) Polyclonal Antibody (Rhesus monkey), PE
  • EUR 324.00
  • EUR 3043.00
  • EUR 850.00
  • EUR 412.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6 (Pro27~Met212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 6 (IL6). This antibody is labeled with PE.
Interleukin 8 (IL8) Polyclonal Antibody (Rhesus monkey), APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL8 (Ala23~Pro101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with APC.
Interleukin 8 (IL8) Polyclonal Antibody (Rhesus monkey), Biotinylated
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL8 (Ala23~Pro101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with Biotin.
Interleukin 8 (IL8) Polyclonal Antibody (Rhesus monkey), Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL8 (Ala23~Pro101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with Cy3.
Interleukin 8 (IL8) Polyclonal Antibody (Rhesus monkey), FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL8 (Ala23~Pro101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with FITC.
Interleukin 8 (IL8) Polyclonal Antibody (Rhesus monkey), HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL8 (Ala23~Pro101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with HRP.
Interleukin 8 (IL8) Polyclonal Antibody (Rhesus monkey), PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL8 (Ala23~Pro101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with PE.
Interleukin 6 (IL6) Monoclonal Antibody (Human, Rhesus monkey)
  • EUR 278.00
  • EUR 3011.00
  • EUR 739.00
  • EUR 355.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Pro27~Met212
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human, Rhesus monkey Interleukin 6 (IL6)
Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ala23~Pro101
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with APC.
Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), Biotinylated
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ala23~Pro101
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with Biotin.
Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ala23~Pro101
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with Cy3.
Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ala23~Pro101
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with FITC.
Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ala23~Pro101
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with HRP.
Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ala23~Pro101
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with PE.
Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with APC.
Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), Biotinylated
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with Biotin.
Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with Cy3.
Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with FITC.
Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with HRP.
Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey), PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8). This antibody is labeled with PE.
Rabbit anti Rhesus Monkey IgG
FNSA-0092 500 uL
EUR 306.6
Description: Rabbit anti Rhesus Monkey IgG secondary antibody
Rabbit anti Rhesus Monkey IgM
FNSA-0093 500 uL
EUR 306.6
Description: Rabbit anti Rhesus Monkey IgM secondary antibody
Genomic DNA - Rhesus Monkey Male
D1534999-G01 100 ug
EUR 188
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
Genomic DNA - Rhesus Monkey Female
D1534999-G02 100 ug
EUR 188
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
Monkey (Rhesus) Methylated DNA Control
D6534149 5 ug Ask for price
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
Non-sterile Rhesus monkey serum
RMS05-0050 50 ml
EUR 741
  • Non-sterile Rhesus monkey serum is indicated as RUO. Do not use on humans.
Non-sterile Rhesus monkey serum
RMS05-0100 100 ml
EUR 1140.1
  • Non-sterile Rhesus monkey serum is indicated as RUO. Do not use on humans.
Non-sterile Rhesus monkey serum
RMS05-0500 500 ml Ask for price
  • Non-sterile Rhesus monkey serum is indicated as RUO. Do not use on humans.
Monoclonal CD4 Antibody, Clone: B486A1
APR15351G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human CD4. The antibodies are raised in Mouse and are from clone B486A1. This antibody is applicable in FC, E
Human Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Hu-48T 48T
EUR 498
  • Should the Human Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cluster Of Differentiation 4 (CD4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Hu-96T 96T
EUR 647
  • Should the Human Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cluster Of Differentiation 4 (CD4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Mu-48T 48T
EUR 508
  • Should the Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cluster Of Differentiation 4 (CD4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Mu-96T 96T
EUR 661
  • Should the Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cluster Of Differentiation 4 (CD4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Ra-48T 48T
EUR 528
  • Should the Rat Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cluster Of Differentiation 4 (CD4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Ra-96T 96T
EUR 690
  • Should the Rat Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cluster Of Differentiation 4 (CD4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Cluster Of Differentiation 4 (CD4) ELISA Kit
RD-CD4-Hu-48Tests 48 Tests
EUR 500
Human Cluster Of Differentiation 4 (CD4) ELISA Kit
RD-CD4-Hu-96Tests 96 Tests
EUR 692
Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit
RD-CD4-Mu-48Tests 48 Tests
EUR 511
Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit
RD-CD4-Mu-96Tests 96 Tests
EUR 709
Rat Cluster Of Differentiation 4 (CD4) ELISA Kit
RD-CD4-Ra-48Tests 48 Tests
EUR 534
Rat Cluster Of Differentiation 4 (CD4) ELISA Kit
RD-CD4-Ra-96Tests 96 Tests
EUR 742
Human Cluster Of Differentiation 4 (CD4) ELISA Kit
RDR-CD4-Hu-48Tests 48 Tests
EUR 522
Human Cluster Of Differentiation 4 (CD4) ELISA Kit
RDR-CD4-Hu-96Tests 96 Tests
EUR 724
Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit
RDR-CD4-Mu-48Tests 48 Tests
EUR 534
Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit
RDR-CD4-Mu-96Tests 96 Tests
EUR 742
Rat Cluster Of Differentiation 4 (CD4) ELISA Kit
RDR-CD4-Ra-48Tests 48 Tests
EUR 558
Rat Cluster Of Differentiation 4 (CD4) ELISA Kit
RDR-CD4-Ra-96Tests 96 Tests
EUR 776
Rhesus macaque CD4 Protein (Lys 26-Trp 390) [His]
VAng-1300Lsx-100g 100 µg
EUR 738
Description: Rhesus macaque CD4, His tag, is expressed in HEK 293 cells. (Uniprot ID: G7N5T8)
Rhesus macaque CD4 Protein (Lys 26-Trp 390) [His]
VAng-1300Lsx-1mg 1 mg
EUR 4449
Description: Rhesus macaque CD4, His tag, is expressed in HEK 293 cells. (Uniprot ID: G7N5T8)
Immunoglobulin A (IgA) Polyclonal Antibody (Rhesus monkey), APC-Cy7
  • EUR 760.00
  • EUR 9130.00
  • EUR 2380.00
  • EUR 1030.00
  • EUR 400.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Immunoglobulin A (IgA). This antibody is labeled with APC-Cy7.
Albumin (ALB) Polyclonal Antibody (Human, Rat, Rhesus monkey, Bovine)
  • EUR 280.00
  • EUR 3024.00
  • EUR 742.00
  • EUR 356.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Native Protein ALB
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Rhesus monkey, Bovine Albumin (ALB)
Hemoglobin (HB) Polyclonal Antibody (Human, Rhesus monkey, Dog), APC
  • EUR 395.00
  • EUR 3977.00
  • EUR 1088.00
  • EUR 510.00
  • EUR 240.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Native Protein Hemoglobin
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rhesus monkey, Dog Hemoglobin (HB). This antibody is labeled with APC.
Hemoglobin (HB) Polyclonal Antibody (Human, Rhesus monkey, Dog), Biotinylated
  • EUR 348.00
  • EUR 2974.00
  • EUR 856.00
  • EUR 432.00
  • EUR 234.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Native Protein Hemoglobin
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rhesus monkey, Dog Hemoglobin (HB). This antibody is labeled with Biotin.
Hemoglobin (HB) Polyclonal Antibody (Human, Rhesus monkey, Dog), Cy3
  • EUR 485.00
  • EUR 5261.00
  • EUR 1409.00
  • EUR 638.00
  • EUR 278.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Native Protein Hemoglobin
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rhesus monkey, Dog Hemoglobin (HB). This antibody is labeled with Cy3.
Hemoglobin (HB) Polyclonal Antibody (Human, Rhesus monkey, Dog), FITC
  • EUR 336.00
  • EUR 3201.00
  • EUR 890.00
  • EUR 428.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Native Protein Hemoglobin
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rhesus monkey, Dog Hemoglobin (HB). This antibody is labeled with FITC.
Hemoglobin (HB) Polyclonal Antibody (Human, Rhesus monkey, Dog), HRP
  • EUR 359.00
  • EUR 3463.00
  • EUR 959.00
  • EUR 458.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Native Protein Hemoglobin
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rhesus monkey, Dog Hemoglobin (HB). This antibody is labeled with HRP.
Hemoglobin (HB) Polyclonal Antibody (Human, Rhesus monkey, Dog), PE
  • EUR 336.00
  • EUR 3201.00
  • EUR 890.00
  • EUR 428.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Native Protein Hemoglobin
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rhesus monkey, Dog Hemoglobin (HB). This antibody is labeled with PE.
Carbonic Anhydrase II (CA2) Monoclonal Antibody (Rhesus monkey), APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Carbonic Anhydrase II (CA2). This antibody is labeled with APC.
Carbonic Anhydrase II (CA2) Monoclonal Antibody (Rhesus monkey), Biotinylated
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Carbonic Anhydrase II (CA2). This antibody is labeled with Biotin.
Carbonic Anhydrase II (CA2) Monoclonal Antibody (Rhesus monkey), Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Carbonic Anhydrase II (CA2). This antibody is labeled with Cy3.
Carbonic Anhydrase II (CA2) Monoclonal Antibody (Rhesus monkey), FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Carbonic Anhydrase II (CA2). This antibody is labeled with FITC.
Carbonic Anhydrase II (CA2) Monoclonal Antibody (Rhesus monkey), HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Carbonic Anhydrase II (CA2). This antibody is labeled with HRP.
Carbonic Anhydrase II (CA2) Monoclonal Antibody (Rhesus monkey), PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Carbonic Anhydrase II (CA2). This antibody is labeled with PE.
Tumor Necrosis Factor Alpha (TNFa) Monoclonal Antibody (Rhesus monkey)
  • EUR 278.00
  • EUR 3011.00
  • EUR 739.00
  • EUR 355.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val77~Leu233
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Tumor Necrosis Factor Alpha (TNFa)
Interleukin 1 Receptor Antagonist (IL1RA) Monoclonal Antibody (Rhesus monkey)
  • EUR 278.00
  • EUR 3011.00
  • EUR 739.00
  • EUR 355.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg26~Glu177
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 1 Receptor Antagonist (IL1RA)
Cathepsin K (CTSK) Monoclonal Antibody (Rhesus monkey), APC-Cy7
  • EUR 666.00
  • EUR 7798.00
  • EUR 2047.00
  • EUR 896.00
  • EUR 360.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Pro116~Met329
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Cathepsin K (CTSK). This antibody is labeled with APC-Cy7.
Tumor Necrosis Factor Alpha (TNFa) Polyclonal Antibody (Rhesus monkey)
  • EUR 270.00
  • EUR 2879.00
  • EUR 709.00
  • EUR 343.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNFa (Val77~Leu233)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Tumor Necrosis Factor Alpha (TNFa)
Glycated Hemoglobin A1c (HbA1c) Polyclonal Antibody (Rhesus monkey), APC
  • EUR 379.00
  • EUR 3761.00
  • EUR 1034.00
  • EUR 488.00
  • EUR 233.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Native Protein
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Glycated Hemoglobin A1c (HbA1c). This antibody is labeled with APC.
Glycated Hemoglobin A1c (HbA1c) Polyclonal Antibody (Rhesus monkey), Biotinylated
  • EUR 336.00
  • EUR 2816.00
  • EUR 816.00
  • EUR 416.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Native Protein
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Glycated Hemoglobin A1c (HbA1c). This antibody is labeled with Biotin.
Glycated Hemoglobin A1c (HbA1c) Polyclonal Antibody (Rhesus monkey), Cy3
  • EUR 464.00
  • EUR 4973.00
  • EUR 1337.00
  • EUR 609.00
  • EUR 270.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Native Protein
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Glycated Hemoglobin A1c (HbA1c). This antibody is labeled with Cy3.
Glycated Hemoglobin A1c (HbA1c) Polyclonal Antibody (Rhesus monkey), FITC
  • EUR 323.00
  • EUR 3028.00
  • EUR 847.00
  • EUR 410.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Native Protein
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Glycated Hemoglobin A1c (HbA1c). This antibody is labeled with FITC.
Glycated Hemoglobin A1c (HbA1c) Polyclonal Antibody (Rhesus monkey), HRP
  • EUR 345.00
  • EUR 3276.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Native Protein
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Glycated Hemoglobin A1c (HbA1c). This antibody is labeled with HRP.
Glycated Hemoglobin A1c (HbA1c) Polyclonal Antibody (Rhesus monkey), PE
  • EUR 323.00
  • EUR 3028.00
  • EUR 847.00
  • EUR 410.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Native Protein
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Glycated Hemoglobin A1c (HbA1c). This antibody is labeled with PE.
Interleukin 1 Receptor Antagonist (IL1RA) Polyclonal Antibody (Rhesus monkey)
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL1RA (Arg26~Glu177)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 1 Receptor Antagonist (IL1RA)
Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), APC-Cy7
  • EUR 641.00
  • EUR 7438.00
  • EUR 1957.00
  • EUR 860.00
  • EUR 349.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with APC-Cy7.


Synthesis of Full-Dimension cDNA Infectious Clones of Soybean Mosaic Virus and Purposeful Identification of a Key Amino Acid inside the Silencing Suppressor Hc-Skilled


  • Soybean mosaic virus (SMV), which belongs to the Potyviridae, causes very important reductions in soybean yield and seed top quality. On this study, every tag-free and reporter gene inexperienced fluorescent protein (GFP)-containing infectious clones for the SMV N1 strain have been constructed by Gibson assembly and with the yeast homologous recombination system, respectively.


  • Every infectious clones are applicable for agroinfiltration on the model host benthamiana and current strong infectivity for the pure host soybean and several other different completely different legume species. Every infectious clones have been seed transmitted and prompted typical virus indicators on seeds and progeny crops. We used the SMV-GFP infectious clone to extra study the operate of key amino acids inside the silencing suppressor helper component-proteinase (Hc-Skilled).


  • Amongst twelve amino acid substitution mutants, the co-expression of mutant 2-with an Asparagine→Leucine substitution at place 182 of the FRNK (Phe-Arg-Asn-Lys) motif-attenuated viral indicators and alleviated the host progress retardation introduced on by SMV.


  • Moreover, the Hc-Prom2 mutant confirmed stronger oligomerization than wild-type Hc-Skilled. Taken collectively, the SMV infectious clones could be useful for analysis of host-SMV interactions and helpful gene characterization in soybeans and related legume species, notably by means of seed transmission properties. Furthermore, the SMV-GFP infectious clone will even facilitate helpful analysis of every virus and host genes in an benthamiana transient expression system.


Profiling of rice Cd-tolerant genes by means of yeast-based cDNA library survival screening

The bioaccumulation of cadmium (Cd) in crop and the following meals chain has aroused intensive concerns. However, the underlying molecular mechanisms of plant Cd tolerance keep to be clarified from the viewpoint of novel candidate genes.


Proper right here we described a extraordinarily surroundings pleasant technique for preliminary determining rice Cd-tolerant genes by means of the yeast-based cDNA library survival screening combined with high-throughput sequencing method. About 690 gene isoforms have been acknowledged as being Cd-tolerant candidates using this shotgun technique.


Among the many many Cd-tolerant genes acknowledged, a variety of lessons of genes harking back to BAX inhibitor (BI), NAC transcription parts and Quick ALkalinization Parts (RALFs) have been of particular curiosity, and their carry out of Cd tolerance was extra validated by means of heterologous expression, which urged that SNAC1, RALF12, OsBI-1 can confer Cd tolerance in yeast and tobacco leaves.


Referring to the genes involved in ion transport, the validated Cd-tolerant heavy metal-associated space (HMAD) isoprenylated protein HIPP42 was considerably noteworthy. Further elucidation of these genes associated to Cd tolerance in rice will revenue agricultural actions.


Single-Cell Transcriptomics of Immune Cells: Cell Isolation and cDNA Library Period for scRNA-Seq


Single-cell RNA-sequencing (scRNA-seq) permits an entire analysis of the transcriptome of explicit particular person cells by next-generation sequencing. ScRNA-seq provides an unbiased technique to research the cellular heterogeneity and dynamics of varied natural strategies, along with the immune system. Optimization of the technical procedures carried out earlier to RNA-seq analysis is essential to the success of a scRNA-seq experiment.


Proper right here, three most important experimental procedures are described: (1) the isolation of immune CD8a+ T cells from most important murine tissue, (2) the expertise of single-cell cDNA libraries using the 10× Genomics Chromium Controller and the Chromium Single Cell 3′ Reply, and (3) cDNA library top quality administration. On this protocol, CD8a+ T cells are isolated from murine spleen tissue, nevertheless any cell sort of curiosity may very well be enriched and used for single-cell cDNA library expertise and subsequent RNA-seq experiments.


Human Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit

RDR-CCR6-Hu-96Tests 96 Tests
EUR 756

Anti-CCR6/CCR6 Antibody

PA1201 100ug/vial
EUR 294


MO15087 100 ug
EUR 409


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCR6 Antibody

ABD10207 100 ug
EUR 438

CCR6 Antibody

37466-100ul 100ul
EUR 252

CCR6 antibody

10R-1071 100 ul
EUR 316
Description: Mouse monoclonal CCR6 antibody

CCR6 antibody

70R-13797 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal CCR6 antibody

CCR6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200

CCR6 Antibody

DF10207 200ul
EUR 304
Description: CCR6 Antibody detects endogenous levels of total CCR6.

CCR6 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

CCR6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

CCR6 Conjugated Antibody

C37466 100ul
EUR 397

CCR6 cloning plasmid

CSB-CL004845HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1125
  • Sequence: atgagcggggaatcaatgaatttcagcgatgttttcgactccagtgaagattattttgtgtcagtcaatacttcatattactcagttgattctgagatgttactgtgctccttgcaggaggtcaggcagttctccaggctatttgtaccgattgcctactccttgatctgtgtct
  • Show more
Description: A cloning plasmid for the CCR6 gene.

CCR6 inhibitor 1

HY-112701 10mg
EUR 911

CCR6 Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Anti-CCR6 Antibody

A00061-1 200ug
EUR 397
Description: Goat Polyclonal CCR6 Antibody. Validated in ELISA, IHC and tested in Human, Mouse.

Anti-CCR6 Antibody

A00957 100ug/vial
EUR 334

CCR6 Polyclonal Antibody

A50105 100 µg
EUR 570.55
Description: kits suitable for this type of research

CCR6 Rabbit pAb

A16206-100ul 100 ul
EUR 308

CCR6 Rabbit pAb

A16206-200ul 200 ul
EUR 459

CCR6 Rabbit pAb

A16206-20ul 20 ul
EUR 183

CCR6 Rabbit pAb

A16206-50ul 50 ul
EUR 223

CCR6 Blocking Peptide

DF10207-BP 1mg
EUR 195

Anti-CCR6 Antibody

STJ500414 100 µg
EUR 476

Anti-CCR6 antibody

STJ118659 100 µl
EUR 277

Human CCR6 ELISA Kit

ELA-E2014h 96 Tests
EUR 824


EF006138 96 Tests
EUR 689

Human CCR6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CCR6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CCR6 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCR6 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCR6 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CCR6 Recombinant Protein (Human)

RP006232 100 ug Ask for price

CCR6 Recombinant Protein (Rat)

RP193790 100 ug Ask for price

CCR6 Recombinant Protein (Mouse)

RP122255 100 ug Ask for price

CCR6 Recombinant Protein (Mouse)

RP122258 100 ug Ask for price

CCR6 Recombinant Protein (Mouse)

RP122261 100 ug Ask for price

CCR6 Recombinant Protein (Mouse)

RP122264 100 ug Ask for price

CCR6 Recombinant Protein (Mouse)
