SPDEF Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

SPDEF Polyclonal Antibody

ES10192-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SPDEF from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SPDEF Rabbit pAb

A14114-100ul 100 ul
EUR 308

SPDEF Rabbit pAb

A14114-200ul 200 ul
EUR 459

SPDEF Rabbit pAb

A14114-20ul 20 ul
EUR 183

SPDEF Rabbit pAb

A14114-50ul 50 ul
EUR 223

SPDEF Rabbit pAb

A6747-100ul 100 ul
EUR 308

SPDEF Rabbit pAb

A6747-200ul 200 ul
EUR 459

SPDEF Rabbit pAb

A6747-20ul 20 ul
EUR 183

SPDEF Rabbit pAb

A6747-50ul 50 ul
EUR 223

SPDEF Antibody

35874-100ul 100ul
EUR 252

SPDEF Antibody

1-CSB-PA874773
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

SPDEF antibody

70R-8298 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SPDEF antibody

SPDEF Antibody

1-CSB-PA022518LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

Polyclonal SPDEF antibody - middle region

APR00614G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPDEF - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal SPDEF antibody - N-terminal region

APR00593G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPDEF - N-terminal region. This antibody is tested and proven to work in the following applications:

SPDEF Conjugated Antibody

C35874 100ul
EUR 397

Anti-SPDEF antibody

STJ28830 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the ETS family of transcription factors. It is highly expressed in the prostate epithelial cells, and functions as an androgen-independent transactivator of prostate-specific antigen (PSA) promoter. Higher expression of this protein has also been reported in brain, breast, lung and ovarian tumors, compared to the corresponding normal tissues, and it shows better tumor-association than other cancer-associated molecules, making it a more suitable target for developing specific cancer therapies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-SPDEF antibody

STJ116049 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the ETS family of transcription factors. It is highly expressed in the prostate epithelial cells, and functions as an androgen-independent transactivator of prostate-specific antigen (PSA) promoter. Higher expression of this protein has also been reported in brain, breast, lung and ovarian tumors, compared to the corresponding normal tissues, and it shows better tumor-association than other cancer-associated molecules, making it a more suitable target for developing specific cancer therapies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-SPDEF antibody

STJ191350 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SPDEF

SPDEF siRNA

20-abx934902
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SPDEF siRNA

20-abx934903
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SPDEF

YF-PA25935 50 ul
EUR 334
Description: Mouse polyclonal to SPDEF

SPDEF Antibody, HRP conjugated

1-CSB-PA022518LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SPDEF Antibody, FITC conjugated

1-CSB-PA022518LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SPDEF Antibody, Biotin conjugated

1-CSB-PA022518LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SPDEF Blocking Peptide

33R-2949 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SPDEF antibody, catalog no. 70R-8298

SPDEF cloning plasmid

CSB-CL022518HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1008
  • Sequence: atgggcagcgccagcccgggtctgagcagcgtatcccccagccacctcctgctgccccccgacacggtgtcgcggacaggcttggagaaggcggcagcgggggcagtgggtctcgagagacgggactggagtcccagtccacccgccacgcccgagcagggcctgtccgccttct
  • Show more
Description: A cloning plasmid for the SPDEF gene.

Anti-SPDEF (4A5)

YF-MA18002 100 ug
EUR 363
Description: Mouse monoclonal to SPDEF

SPDEF ELISA KIT|Human

EF005474 96 Tests
EUR 689

Human SPDEF ELISA KIT

ELI-52217h 96 Tests
EUR 824

Mouse Spdef ELISA KIT

ELI-42551m 96 Tests
EUR 865

Mouse SPDEF shRNA Plasmid

20-abx974014
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SPDEF shRNA Plasmid

20-abx958507
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SPDEF Recombinant Protein (Rat)

RP230720 100 ug Ask for price

SPDEF Recombinant Protein (Human)

RP029854 100 ug Ask for price

SPDEF Recombinant Protein (Mouse)

RP174884 100 ug Ask for price

Monoclonal SPDEF Antibody (monoclonal) (M01), Clone: 4A5

AMM04127G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human SPDEF (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4A5. This antibody is applicable in WB, E

Spdef ORF Vector (Rat) (pORF)

ORF076908 1.0 ug DNA
EUR 506

SPDEF ORF Vector (Human) (pORF)

ORF009952 1.0 ug DNA
EUR 95

Spdef ORF Vector (Mouse) (pORF)

ORF058296 1.0 ug DNA
EUR 506

pENTR223-SPDEF-599G-C997 vector

PVT11948 2 ug
EUR 308

SPDEF ELISA Kit (Human) (OKCA01500)

OKCA01500 96 Wells
EUR 846
Description: Description of target: May function as an androgen-independent transactivator of the prostate-specific antigen (PSA) promoter. Binds to 5'-GGAT-3' DNA sequences. May play a role in the regulation of the prostate gland and/or prostate cancer development. Acts as a transcriptional activator for SERPINB5 promoter.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 15.6 pg/mL

SPDEF ELISA Kit (Human) (OKEH08557)

OKEH08557 96 Wells
EUR 896
Description: Description of target: The protein encoded by this gene belongs to the ETS family of transcription factors. It is highly expressed in the prostate epithelial cells, and functions as an androgen-independent transactivator of prostate-specific antigen (PSA) promoter. Higher expression of this protein has also been reported in brain, breast, lung and ovarian tumors, compared to the corresponding normal tissues, and it shows better tumor-association than other cancer-associated molecules, making it a more suitable target for developing specific cancer therapies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.35ng/mL

SPDEF ELISA Kit (Mouse) (OKEH08558)

OKEH08558 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156ng/mL

Spdef sgRNA CRISPR Lentivector set (Rat)

K6696201 3 x 1.0 ug
EUR 339

Spdef sgRNA CRISPR Lentivector set (Mouse)

K3873401 3 x 1.0 ug
EUR 339

SPDEF sgRNA CRISPR Lentivector set (Human)

K2269901 3 x 1.0 ug
EUR 339

SAM Pointed Domain-Containing Ets Transcription Factor (SPDEF) Antibody

20-abx006389
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

SAM pointed domain-containing Ets transcription factor (SPDEF) Antibody

20-abx212939
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

SAM Pointed Domain-Containing Ets Transcription Factor (SPDEF) Antibody

abx145115-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

SAM Pointed Domain-Containing Ets Transcription Factor (SPDEF) Antibody

20-abx317850
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Spdef sgRNA CRISPR Lentivector (Rat) (Target 1)

K6696202 1.0 ug DNA
EUR 154

Spdef sgRNA CRISPR Lentivector (Rat) (Target 2)

K6696203 1.0 ug DNA
EUR 154

Spdef sgRNA CRISPR Lentivector (Rat) (Target 3)

K6696204 1.0 ug DNA
EUR 154

Spdef sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3873402 1.0 ug DNA
EUR 154

Spdef sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3873403 1.0 ug DNA
EUR 154

Spdef sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3873404 1.0 ug DNA
EUR 154

SPDEF sgRNA CRISPR Lentivector (Human) (Target 1)

K2269902 1.0 ug DNA
EUR 154

SPDEF sgRNA CRISPR Lentivector (Human) (Target 2)

K2269903 1.0 ug DNA
EUR 154

SPDEF sgRNA CRISPR Lentivector (Human) (Target 3)

K2269904 1.0 ug DNA
EUR 154

SPDEF Protein Vector (Rat) (pPB-C-His)

PV307630 500 ng
EUR 603

SPDEF Protein Vector (Rat) (pPB-N-His)

PV307631 500 ng
EUR 603

SPDEF Protein Vector (Rat) (pPM-C-HA)

PV307632 500 ng
EUR 603

SPDEF Protein Vector (Rat) (pPM-C-His)

PV307633 500 ng
EUR 603

SPDEF Protein Vector (Human) (pPB-C-His)

PV039805 500 ng
EUR 329

SPDEF Protein Vector (Human) (pPB-N-His)

PV039806 500 ng
EUR 329

SPDEF Protein Vector (Human) (pPM-C-HA)

PV039807 500 ng
EUR 329

SPDEF Protein Vector (Human) (pPM-C-His)

PV039808 500 ng
EUR 329

SPDEF Protein Vector (Mouse) (pPB-C-His)

PV233182 500 ng
EUR 603

SPDEF Protein Vector (Mouse) (pPB-N-His)

PV233183 500 ng
EUR 603

SPDEF Protein Vector (Mouse) (pPM-C-HA)

PV233184 500 ng
EUR 603

SPDEF Protein Vector (Mouse) (pPM-C-His)

PV233185 500 ng
EUR 603

Spdef 3'UTR Luciferase Stable Cell Line

TU119556 1.0 ml Ask for price

Spdef 3'UTR GFP Stable Cell Line

TU169556 1.0 ml Ask for price

Spdef 3'UTR Luciferase Stable Cell Line

TU221056 1.0 ml Ask for price

SPDEF 3'UTR GFP Stable Cell Line

TU074433 1.0 ml
EUR 1394

Spdef 3'UTR GFP Stable Cell Line

TU271056 1.0 ml Ask for price

SPDEF 3'UTR Luciferase Stable Cell Line

TU024433 1.0 ml
EUR 1394

SPDEF Rabbit Polyclonal Antibody