SRP54 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

SRP54 Polyclonal Antibody

ABP60513-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SRP54 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SRP54 from Human, Mouse, Rat. This SRP54 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SRP54 protein

SRP54 Polyclonal Antibody

ABP60513-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SRP54 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SRP54 from Human, Mouse, Rat. This SRP54 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SRP54 protein

SRP54 Polyclonal Antibody

A63498 100 µg
EUR 570.55
Description: Ask the seller for details

SRP54 Rabbit pAb

A4126-100ul 100 ul
EUR 308

SRP54 Rabbit pAb

A4126-200ul 200 ul
EUR 459

SRP54 Rabbit pAb

A4126-20ul 20 ul
EUR 183

SRP54 Rabbit pAb

A4126-50ul 50 ul
EUR 223

SRP54 antibody

70R-4849 50 ug
EUR 467
Description: Rabbit polyclonal SRP54 antibody raised against the middle region of SRP54

SRP54 Antibody

40106-100ul 100ul
EUR 252

SRP54 antibody

70R-20523 50 ul
EUR 435
Description: Rabbit polyclonal SRP54 antibody

SRP54 Antibody

DF12479 200ul
EUR 304
Description: SRP54 antibody detects endogenous levels of SRP54.

SRP54 Antibody

1-CSB-PA228089
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

SRP54 Antibody

1-CSB-PA080227
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

SRP54 Antibody

1-CSB-PA022675GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SRP54 Antibody

1-CSB-PA022675LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

SRP54 Polyclonal Antibody, HRP Conjugated

A63499 100 µg
EUR 570.55
Description: The best epigenetics products

SRP54 Polyclonal Antibody, FITC Conjugated

A63500 100 µg
EUR 570.55
Description: kits suitable for this type of research

SRP54 Polyclonal Antibody, Biotin Conjugated

A63501 100 µg
EUR 570.55
Description: fast delivery possible

Srp54/ Rat Srp54 ELISA Kit

ELI-29869r 96 Tests
EUR 886

SRP54 Conjugated Antibody

C40106 100ul
EUR 397

anti- SRP54 antibody

FNab08232 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:500-1:1000
  • IHC:1:20-1:200
  • Immunogen: signal recognition particle 54kDa
  • Uniprot ID: P61011
  • Gene ID: 6729
  • Research Area: Epigenetics, Signal Transduction, Metabolism
Description: Antibody raised against SRP54

anti- SRP54 antibody

FNab08233 100µg
EUR 548.75
  • Immunogen: signal recognition particle 54kDa
  • Uniprot ID: P61011
  • Gene ID: 6729
  • Research Area: Epigenetics, Signal Transduction, Metabolism
Description: Antibody raised against SRP54

Anti-SRP54 antibody

PAab08232 100 ug
EUR 386

Anti-SRP54 antibody

PAab08233 100 ug
EUR 386

Anti-SRP54 antibody

STJ25695 100 µl
EUR 277

Anti-SRP54 antibody

STJ191418 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SRP54

SRP54 siRNA

20-abx935170
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SRP54 siRNA

20-abx935171
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SRP54 Antibody, HRP conjugated

1-CSB-PA022675LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SRP54 Antibody, FITC conjugated

1-CSB-PA022675LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SRP54 Antibody, Biotin conjugated

1-CSB-PA022675LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP54. Recognizes SRP54 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SRP54 cloning plasmid

CSB-CL022675HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1515
  • Sequence: atggttctagcagaccttggaagaaaaataacatcagcattacgctcgttgagcaatgccaccattatcaatgaagaggtattgaatgctatgctaaaagaagtctgtaccgctttgttggaagcagatgttaatattaaactagtgaagcaactaagagaaaatgttaagtctg
  • Show more
Description: A cloning plasmid for the SRP54 gene.

SRP54 cloning plasmid

CSB-CL022675HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1515
  • Sequence: atggttctagcagaccttggaagaaaaataacatcagcattacgctcattgagcaatgccaccattatcaatgaagaggtattgaatgctatgctaaaagaagtctgtaccgctttgttggaagcagatgttaatattaaactagtgaagcaactaagagaaaatgttaagtctg
  • Show more
Description: A cloning plasmid for the SRP54 gene.

SRP54 Blocking Peptide

33R-2603 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SRP54 antibody, catalog no. 70R-4849

SRP54 Blocking Peptide

DF12479-BP 1mg
EUR 195

pCMV-SPORT6-SRP54

PVT18220 2 ug
EUR 231

pCMV-SPORT6-SRP54

PVT12424 2 ug
EUR 391

Anti-SRP54 (2G7)

YF-MA15608 100 ug
EUR 363
Description: Mouse monoclonal to SRP54

Rat SRP54 shRNA Plasmid

20-abx987313
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SRP54 ELISA KIT|Human

EF003237 96 Tests
EUR 689

Canine SRP54 ELISA KIT

ELI-52679d 96 Tests
EUR 928

Bovine SRP54 ELISA KIT

ELI-53441b 96 Tests
EUR 928

Human SRP54 ELISA KIT

ELI-29458h 96 Tests
EUR 824

Mouse Srp54 ELISA KIT

ELI-41414m 96 Tests
EUR 865

Human SRP54 shRNA Plasmid

20-abx954596
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SRP54 Recombinant Protein (Human)

RP030088 100 ug Ask for price

SRP54 Recombinant Protein (Human)

RP030091 100 ug Ask for price

SRP54 Recombinant Protein (Rat)

RP231059 100 ug Ask for price

pECMV-3-FLAG-SRP54

PVT13001 2 ug
EUR 325

Signal Recognition Particle 54 (SRP54) Antibody

20-abx003041
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Signal Recognition Particle 54 (SRP54) Antibody

abx028937-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Signal Recognition Particle 54 (SRP54) Antibody

abx028937-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Signal Recognition Particle 54 (SRP54) Antibody

20-abx214067
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Signal Recognition Particle 54 (SRP54) Antibody

20-abx214893
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Signal Recognition Particle 54 (SRP54) Antibody

20-abx318796
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Signal Recognition Particle 54 (SRP54) Antibody

abx238232-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Signal Recognition Particle 54 (SRP54) Antibody

abx238233-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Signal Recognition Particle 54 (SRP54) Antibody

20-abx305428
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Signal Recognition Particle 54 (SRP54) Antibody (HRP)

20-abx316640
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Signal Recognition Particle 54 (SRP54) Antibody (FITC)

20-abx316641
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Signal Recognition Particle 54 (SRP54) Antibody (Biotin)

20-abx316642
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Signal Recognition Particle 54 (SRP54) Antibody (HRP)

20-abx305429
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Signal Recognition Particle 54 (SRP54) Antibody (FITC)

20-abx305430
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Signal Recognition Particle 54 (SRP54) Antibody (Biotin)

20-abx305431
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SRP54 ORF Vector (Human) (pORF)

ORF010030 1.0 ug DNA
EUR 95

SRP54 ORF Vector (Human) (pORF)

ORF010031 1.0 ug DNA
EUR 95

Srp54 ORF Vector (Rat) (pORF)

ORF077021 1.0 ug DNA
EUR 506

SRP54 ELISA Kit (Human) (OKEH07767)

OKEH07767 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.091ng/mL

SRP54 sgRNA CRISPR Lentivector set (Human)

K2286301 3 x 1.0 ug
EUR 339

SRP54 sgRNA CRISPR Lentivector (Human) (Target 1)

K2286302 1.0 ug DNA
EUR 154

SRP54 sgRNA CRISPR Lentivector (Human) (Target 2)

K2286303 1.0 ug DNA
EUR 154

SRP54 sgRNA CRISPR Lentivector (Human) (Target 3)

K2286304 1.0 ug DNA
EUR 154

SRP54 Protein Vector (Human) (pPB-C-His)

PV040117 500 ng
EUR 329

SRP54 Protein Vector (Human) (pPB-N-His)

PV040118 500 ng
EUR 329

SRP54 Protein Vector (Human) (pPM-C-HA)

PV040119 500 ng
EUR 329

SRP54 Protein Vector (Human) (pPM-C-His)

PV040120 500 ng
EUR 329

SRP54 Protein Vector (Human) (pPB-C-His)

PV040121 500 ng
EUR 329

SRP54 Protein Vector (Human) (pPB-N-His)

PV040122 500 ng
EUR 329

SRP54 Protein Vector (Human) (pPM-C-HA)

PV040123 500 ng
EUR 329

SRP54 Protein Vector (Human) (pPM-C-His)

PV040124 500 ng
EUR 329

Recombinant Human SRP54 Protein, His, Insect-1mg

QP13591-1mg 1mg
EUR 3954

Recombinant Human SRP54 Protein, His, Insect-20ug

QP13591-20ug 20ug
EUR 201

Recombinant Human SRP54 Protein, His, Insect-5ug

QP13591-5ug 5ug
EUR 155

SRP54 Protein Vector (Rat) (pPB-C-His)

PV308082 500 ng
EUR 603

SRP54 Protein Vector (Rat) (pPB-N-His)

PV308083 500 ng
EUR 603

SRP54 Protein Vector (Rat) (pPM-C-HA)

PV308084 500 ng
EUR 603

SRP54 Protein Vector (Rat) (pPM-C-His)

PV308085 500 ng
EUR 603

SRP54 3'UTR GFP Stable Cell Line

TU074603 1.0 ml
EUR 1394

SRP54 3'UTR Luciferase Stable Cell Line

TU024603 1.0 ml
EUR 1394

Human Signal Recognition Particle 54 (SRP54) ELISA Kit

20-abx383459
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Signal recognition particle 54 kDa protein (SRP54)

1-CSB-EP022675HU
  • EUR 437.00
  • EUR 238.00
  • EUR 1544.00
  • EUR 653.00
  • EUR 1029.00
  • EUR 296.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 69.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Signal recognition particle 54 kDa protein(SRP54) expressed in E.coli

SRP54 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV662977 1.0 ug DNA
EUR 682

SRP54 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV662981 1.0 ug DNA
EUR 682

SRP54 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV662982 1.0 ug DNA
EUR 682

SRP54 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV715431 1.0 ug DNA
EUR 316

SRP54 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV715435 1.0 ug DNA
EUR 316

SRP54 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV715436 1.0 ug DNA
EUR 316

SRP54 Signal Recognition Particle 54kDa Human Recombinant Protein

PROTP61011 Regular: 20ug
EUR 317
Description: SRP54 is a full-length cDNA coding for the human SRP54 protein having a molecular mass of 56,528 Dalton (pH 8.9). SRP54 protein is fused to a hexa-histidine purification tag.

Recombinant Candida Albicans SRP54 Protein (aa 1-556)

VAng-Lsx05987-inquire inquire Ask for price
Description: Candida Albicans Signal recognition particle 54 kDa protein homolog, recombinant protein.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

SRP54 Rabbit Polyclonal Antibody